Blast performed on March-19-2010
BLASTN 2.2.13 [Nov-27-2005]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) 
           4,613,659 sequences; 18,017,093,371 total letters



Query= EG31128 sokC (55 letters)

Distribution of 16 Blast Hits on the Query Sequence




                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AE005674.1|  Shigella flexneri 2a str. 301, complete genome    109   7e-22 
gb|AF387550.1|  Uncultured bacterium clone pAM3 Gef protein ...   109   7e-22 
dbj|AP009048.1|  Escherichia coli str. K12 substr. W3110 DNA...   109   7e-22 
gb|U00096.2|  Escherichia coli str. K-12 substr. MG1655, com...   109   7e-22 Geo
gb|AE014073.1|  Shigella flexneri 2a str. 2457T, complete ge...   109   7e-22 
emb|X17311.1|  E.coli DNA for gef gene                            109   7e-22 
gb|CP000266.1|  Shigella flexneri 5 str. 8401, complete genome    101   2e-19 
dbj|BA000007.2|  Escherichia coli O157:H7 str. Sakai DNA, co...   101   2e-19 
gb|CP000036.1|  Shigella boydii Sb227, complete genome            101   2e-19 
gb|CP000034.1|  Shigella dysenteriae Sd197, complete genome       101   2e-19 
gb|AE005174.2|  Escherichia coli O157:H7 EDL933, complete ge...   101   2e-19 
gb|CP000468.1|  Escherichia coli APEC O1, complete genome          94   4e-17 
gb|CP000247.1|  Escherichia coli 536, complete genome              94   4e-17 
gb|CP000243.1|  Escherichia coli UTI89, complete genome            94   4e-17 
gb|AE014075.1|  Escherichia coli CFT073, complete genome           94   4e-17 
gb|CP000038.1|  Shigella sonnei Ss046, complete genome             94   4e-17 
>gb|AE005674.1| Shigella flexneri 2a str. 301, complete genome
          Length = 4607203

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                    
Query: 1     gttcagcatataggaggcctcgggttgatggtaaaatatcactcggggcttttct 55
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 15602 gttcagcatataggaggcctcgggttgatggtaaaatatcactcggggcttttct 15656
>gb|AF387550.1| Uncultured bacterium clone pAM3 Gef protein (gef), Na+/H+ antiporter
            (nhaA), and regulator (nhaR) genes, complete cds
          Length = 5086

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                   
Query: 1    gttcagcatataggaggcctcgggttgatggtaaaatatcactcggggcttttct 55
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1573 gttcagcatataggaggcctcgggttgatggtaaaatatcactcggggcttttct 1627
>dbj|AP009048.1| Escherichia coli str. K12 substr. W3110 DNA, complete genome
          Length = 4646332

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                    
Query: 1     gttcagcatataggaggcctcgggttgatggtaaaatatcactcggggcttttct 55
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 16952 gttcagcatataggaggcctcgggttgatggtaaaatatcactcggggcttttct 17006
>gb|U00096.2| Escherichia coli str. K-12 substr. MG1655, complete genome
          Length = 4639675

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                    
Query: 1     gttcagcatataggaggcctcgggttgatggtaaaatatcactcggggcttttct 55
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 16952 gttcagcatataggaggcctcgggttgatggtaaaatatcactcggggcttttct 17006
>gb|AE014073.1| Shigella flexneri 2a str. 2457T, complete genome
          Length = 4599354

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                    
Query: 1     gttcagcatataggaggcctcgggttgatggtaaaatatcactcggggcttttct 55
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 15602 gttcagcatataggaggcctcgggttgatggtaaaatatcactcggggcttttct 15656
>emb|X17311.1| E.coli DNA for gef gene
          Length = 780

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Minus

                                                                  
Query: 1   gttcagcatataggaggcctcgggttgatggtaaaatatcactcggggcttttct 55
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 347 gttcagcatataggaggcctcgggttgatggtaaaatatcactcggggcttttct 293
>gb|CP000266.1| Shigella flexneri 5 str. 8401, complete genome
          Length = 4574284

 Score =  101 bits (51), Expect = 2e-19
 Identities = 54/55 (98%)
 Strand = Plus / Plus

                                                                    
Query: 1     gttcagcatataggaggcctcgggttgatggtaaaatatcactcggggcttttct 55
             |||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 15668 gttcagcatatagggggcctcgggttgatggtaaaatatcactcggggcttttct 15722
>dbj|BA000007.2| Escherichia coli O157:H7 str. Sakai DNA, complete genome
          Length = 5498450

 Score =  101 bits (51), Expect = 2e-19
 Identities = 54/55 (98%)
 Strand = Plus / Plus

                                                                    
Query: 1     gttcagcatataggaggcctcgggttgatggtaaaatatcactcggggcttttct 55
             |||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 15620 gttcagcatatagggggcctcgggttgatggtaaaatatcactcggggcttttct 15674
>gb|CP000036.1| Shigella boydii Sb227, complete genome
          Length = 4519823

 Score =  101 bits (51), Expect = 2e-19
 Identities = 54/55 (98%)
 Strand = Plus / Plus

                                                                    
Query: 1     gttcagcatataggaggcctcgggttgatggtaaaatatcactcggggcttttct 55
             |||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 16741 gttcagcatatagggggcctcgggttgatggtaaaatatcactcggggcttttct 16795
>gb|CP000034.1| Shigella dysenteriae Sd197, complete genome
          Length = 4369232

 Score =  101 bits (51), Expect = 2e-19
 Identities = 54/55 (98%)
 Strand = Plus / Plus

                                                                    
Query: 1     gttcagcatataggaggcctcgggttgatggtaaaatatcactcggggcttttct 55
             |||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 15595 gttcagcatatagggggcctcgggttgatggtaaaatatcactcggggcttttct 15649
>gb|AE005174.2| Escherichia coli O157:H7 EDL933, complete genome
          Length = 5528445

 Score =  101 bits (51), Expect = 2e-19
 Identities = 54/55 (98%)
 Strand = Plus / Plus

                                                                    
Query: 1     gttcagcatataggaggcctcgggttgatggtaaaatatcactcggggcttttct 55
             |||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 15620 gttcagcatatagggggcctcgggttgatggtaaaatatcactcggggcttttct 15674
>gb|CP000468.1| Escherichia coli APEC O1, complete genome
          Length = 5082025

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                    
Query: 1     gttcagcatataggaggcctcgggttgatggtaaaatatcactcggggcttttct 55
             |||| ||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 15636 gttctgcatatagggggcctcgggttgatggtaaaatatcactcggggcttttct 15690
>gb|CP000247.1| Escherichia coli 536, complete genome
          Length = 4938920

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                    
Query: 1     gttcagcatataggaggcctcgggttgatggtaaaatatcactcggggcttttct 55
             |||| ||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 15668 gttctgcatatagggggcctcgggttgatggtaaaatatcactcggggcttttct 15722
>gb|CP000243.1| Escherichia coli UTI89, complete genome
          Length = 5065741

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                    
Query: 1     gttcagcatataggaggcctcgggttgatggtaaaatatcactcggggcttttct 55
             |||| ||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 15655 gttctgcatatagggggcctcgggttgatggtaaaatatcactcggggcttttct 15709
>gb|AE014075.1| Escherichia coli CFT073, complete genome
          Length = 5231428

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                    
Query: 1     gttcagcatataggaggcctcgggttgatggtaaaatatcactcggggcttttct 55
             |||| ||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 16387 gttctgcatatagggggcctcgggttgatggtaaaatatcactcggggcttttct 16441
>gb|CP000038.1| Shigella sonnei Ss046, complete genome
          Length = 4825265

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                    
Query: 1     gttcagcatataggaggcctcgggttgatggtaaaatatcactcggggcttttct 55
             |||||||||||||| |||||||||||||| |||||||||||||||||||||||||
Sbjct: 16379 gttcagcatatagggggcctcgggttgatagtaaaatatcactcggggcttttct 16433
  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Mar 11, 2010  5:43 PM
  Number of letters in database: 3,565,734,935
  Number of sequences in database:  913,484
  
  Database: /data/DB/nt.01
    Posted date:  Mar 11, 2010  4:14 PM
  Number of letters in database: 3,760,771,332
  Number of sequences in database:  709,306
  
  Database: /data/DB/nt.02
    Posted date:  Mar 11, 2010  4:14 PM
  Number of letters in database: 3,449,861,827
  Number of sequences in database:  676,052
  
  Database: /data/DB/nt.03
    Posted date:  Mar 11, 2010  4:15 PM
  Number of letters in database: 3,621,733,482
  Number of sequences in database:  898,670
  
  Database: /data/DB/nt.04
    Posted date:  Mar 11, 2010  4:15 PM
  Number of letters in database: 3,618,991,795
  Number of sequences in database:  1,416,147
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 386,094
Number of Sequences: 4613659
Number of extensions: 386094
Number of successful extensions: 83935
Number of sequences better than 1.0e-01: 16
Number of HSP's better than  0.1 without gapping: 16
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 83660
Number of HSP's gapped (non-prelim): 275
length of query: 55
length of database: 18,017,093,371
effective HSP length: 20
effective length of query: 35
effective length of database: 17,924,820,191
effective search space: 627368706685
effective search space used: 627368706685
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 22 (44.1 bits)