yjhF

  # bp Upstream # bp Downstream
>EG12548 yjhF Predicted GntP family transporter, function unknown
ATGCCACTAATTATCGTTGTGGCAGGGATTGCTTTACTCCTGCTTTTAACCATAAAAATTAAGCTTAATACGTTT
GTTTCGTTAATTATTGTCTCGATTGCTGTCGCCATCGCCAGTGGTATGGATTTGAGTAAAGTCGTCACCTCAGTC
GAATCCGGACTTGGCGGTACGCTGGGCCATATTGGTTTGATATTTGGCTTCGGTGTTATGCTCGGTCGCTTGCTG
GCCGATGCGGGTGGTGCGCAGCGAATAGCGCTGACCATGCTGAATTATTTCGGGAAAAATAAACTTGACTGGGCA
GTGGTCTGTTCGGCGTTTATTGTCGGTATCGCACTTTTTTTCGAAGTCGGTTTAATTCTTCTGGTACCTATTTTA
TTCGCTATTGCCCGTGAAGCAAAAATATCACCGATGTTTATGTGTGTGCCGATGCTTTCTGGTTTGCTGGTCGCA
CACGGTTTTTTGCCGCCGCACCCCGGCCCGACTGTTATCGCCAGGGAATATGGCGCTGATGTAGGATTGGTACTG
ATATACGGTATCATTGTCGGCATTCCAACCTTTATTCTTTGCGGCCCGGTATTGAATAAATTCTGCCAGCGCATT
ATTCCGGACGCCTTTAAAAAAGAGGGGAATATAGCCTCTCTCGGCGCGACCCGCCGATTCAGCGAAAGCGAAATG
CCAGGCTTTGGGATCAGTTTTCTCACGGCAATGCTGCCGGTGATCCTGATGGCGGTTGTCACCATCATCCAGATG
ACTCATGCCAAAAGTGCCGCGGATTCAGGCTTATTTTACAACGTGATACTGTTCTTAGGTAATTCAACGATCGCC
ATGCTGATTTCACTGCTATTCGCGATCTATACCATGGGCCTGGGGCGCGGGAAAACAATCCCTGACCTGATGGAT
TCTTGCGGAAAAGCTATCGCGGGTATTGCCGGTCTGCTGCTGATTATCGGTGGTGGTGGTGCATTCAAGCAAGTT
CTCATCGACTCTGGCGTTGGTCAGTATATTTCCACCCTGGTTTCGGGTATGGATATTAACCCGATCCTGATGGCC
TGGGGCGTGGCCGCATTCCTGCGTATTTGTCTGGGTTCAGCCACCGTCGCGGCGATCTCTACCGCCGGTCTGGTC
ATCCCATTGTTGGCAGTACATCCCAATACCAACCTGGCCTTGATTACGCTGGCTACCGGTGCCGGATCCTGTATT
TGTTCTCACGTTAACGATGCCAGTTTCTGGATGATTAAAGACTTTTTTGGCCTGACCACCAAAGAAACGCTGTTA
TCCTGGACGCTGATGTCCACACTCTTATCCATCAGTGGGCTGATTTTTATTCTGCTCGCCAGCTTAGTTTTATAA