yjhF

  # bp Upstream # bp Downstream


>EG12548 yjhF Predicted GntP family transporter, function unknown ATGCCACTAATTATCGTTGTGGCAGGGATTGCTTTACTCCTGCTTTTAACCATAAAAATTAAGCTTAATACGTTT GTTTCGTTAATTATTGTCTCGATTGCTGTCGCCATCGCCAGTGGTATGGATTTGAGTAAAGTCGTCACCTCAGTC GAATCCGGACTTGGCGGTACGCTGGGCCATATTGGTTTGATATTTGGCTTCGGTGTTATGCTCGGTCGCTTGCTG GCCGATGCGGGTGGTGCGCAGCGAATAGCGCTGACCATGCTGAATTATTTCGGGAAAAATAAACTTGACTGGGCA GTGGTCTGTTCGGCGTTTATTGTCGGTATCGCACTTTTTTTCGAAGTCGGTTTAATTCTTCTGGTACCTATTTTA TTCGCTATTGCCCGTGAAGCAAAAATATCACCGATGTTTATGTGTGTGCCGATGCTTTCTGGTTTGCTGGTCGCA CACGGTTTTTTGCCGCCGCACCCCGGCCCGACTGTTATCGCCAGGGAATATGGCGCTGATGTAGGATTGGTACTG ATATACGGTATCATTGTCGGCATTCCAACCTTTATTCTTTGCGGCCCGGTATTGAATAAATTCTGCCAGCGCATT ATTCCGGACGCCTTTAAAAAAGAGGGGAATATAGCCTCTCTCGGCGCGACCCGCCGATTCAGCGAAAGCGAAATG CCAGGCTTTGGGATCAGTTTTCTCACGGCAATGCTGCCGGTGATCCTGATGGCGGTTGTCACCATCATCCAGATG ACTCATGCCAAAAGTGCCGCGGATTCAGGCTTATTTTACAACGTGATACTGTTCTTAGGTAATTCAACGATCGCC ATGCTGATTTCACTGCTATTCGCGATCTATACCATGGGCCTGGGGCGCGGGAAAACAATCCCTGACCTGATGGAT TCTTGCGGAAAAGCTATCGCGGGTATTGCCGGTCTGCTGCTGATTATCGGTGGTGGTGGTGCATTCAAGCAAGTT CTCATCGACTCTGGCGTTGGTCAGTATATTTCCACCCTGGTTTCGGGTATGGATATTAACCCGATCCTGATGGCC TGGGGCGTGGCCGCATTCCTGCGTATTTGTCTGGGTTCAGCCACCGTCGCGGCGATCTCTACCGCCGGTCTGGTC ATCCCATTGTTGGCAGTACATCCCAATACCAACCTGGCCTTGATTACGCTGGCTACCGGTGCCGGATCCTGTATT TGTTCTCACGTTAACGATGCCAGTTTCTGGATGATTAAAGACTTTTTTGGCCTGACCACCAAAGAAACGCTGTTA TCCTGGACGCTGATGTCCACACTCTTATCCATCAGTGGGCTGATTTTTATTCTGCTCGCCAGCTTAGTTTTATAA