Blast performed on June-20-2016
BLASTN 2.2.24+


Reference:
Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000),
"A greedy algorithm for aligning DNA sequences", J Comput Biol 2000;
7(1-2):203-14.



Database: Nucleotide collection (nt)
           36,723,768 sequences; 118,474,747,968 total letters



Query=  EG30063 micF 
Length=93
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

gb|CP014348.1|  Escherichia coli str. K-12 substr. MG1655 strain ...   172    7e-40
gb|CP014092.1|  Escherichia coli strain 268-78-1, complete genome      172    7e-40
gb|CP014272.1|  Escherichia coli K-12 strain C3026, complete genome    172    7e-40
gb|CP014270.1|  Escherichia coli K-12 strain DHB4, complete genome     172    7e-40
gb|CP014225.1|  Escherichia coli str. K-12 substr. MG1655, comple...   172    7e-40
gb|CP013253.1|  Escherichia coli strain CQSW20, complete genome        172    7e-40
gb|CP013048.1|  Escherichia coli strain RS76 genome                    172    7e-40
gb|CP013029.1|  Escherichia coli strain 2012C-4227, complete genome    172    7e-40
gb|CP011343.2|  Escherichia coli K-12 GM4792 Lac-, complete genome     172    7e-40
gb|CP011342.2|  Escherichia coli K-12 GM4792 Lac+, complete genome     172    7e-40
gb|CP012870.1|  Escherichia coli strain K-12 substrain MG1655_TMP...   172    7e-40
gb|CP012869.1|  Escherichia coli strain K-12 substrain MG1655_TMP...   172    7e-40
gb|CP012868.1|  Escherichia coli str. K-12 substr. MG1655, comple...   172    7e-40
emb|LN877770.1|  Escherichia coli genome assembly ERS742059, chro...   172    7e-40
gb|CP011113.1|  Escherichia coli strain RR1, complete genome           172    7e-40
gb|CP012127.1|  Escherichia coli strain DH1Ec169, complete genome      172    7e-40
gb|CP012126.1|  Escherichia coli strain DH1Ec104, complete genome      172    7e-40
gb|CP012125.1|  Escherichia coli strain DH1Ec095, complete genome      172    7e-40
gb|CP011495.1|  Escherichia coli strain NCM3722, complete genome       172    7e-40
gb|CP009106.2|  Escherichia coli strain 94-3024, complete genome       172    7e-40
gb|CP006636.1|  Escherichia coli PCN061, complete genome               172    7e-40
gb|CP011324.1|  Escherichia coli strain SQ2203, complete genome        172    7e-40
gb|CP011323.1|  Escherichia coli strain SQ171, complete genome         172    7e-40
gb|CP011322.1|  Escherichia coli strain SQ110, complete genome         172    7e-40
gb|CP011321.1|  Escherichia coli strain SQ88, complete genome          172    7e-40
gb|CP011320.1|  Escherichia coli strain SQ37, complete genome          172    7e-40
gb|CP010445.1|  Escherichia coli K-12 strain ER3435, complete genome   172    7e-40
gb|CP010444.1|  Escherichia coli K-12 strain ER3475, complete genome   172    7e-40
gb|CP010443.1|  Escherichia coli K-12 strain ER3446, complete genome   172    7e-40
gb|CP010442.1|  Escherichia coli K-12 strain ER3466, complete genome   172    7e-40
gb|CP010441.1|  Escherichia coli K-12 strain ER3445, complete genome   172    7e-40
gb|CP010440.1|  Escherichia coli K-12 strain ER3476, complete genome   172    7e-40
gb|CP010439.1|  Escherichia coli K-12 strain ER3440, complete genome   172    7e-40
gb|CP010438.1|  Escherichia coli K-12 strain ER3454, complete genome   172    7e-40
emb|LN832404.1|  Escherichia coli K-12 genome assembly EcoliK12AG...   172    7e-40
gb|CP011134.1|  Escherichia coli VR50, complete genome                 172    7e-40
gb|CP010344.1|  Escherichia coli ECC-1470, complete genome             172    7e-40
gb|CP009166.1|  Escherichia coli 1303, complete genome                 172    7e-40
gb|CP010456.1|  Synthetic Escherichia coli C321.deltaA substrain ...   172    7e-40
gb|CP010455.1|  Synthetic Escherichia coli C321.deltaA substrain ...   172    7e-40
gb|CP010371.1|  Escherichia coli strain 6409, complete genome          172    7e-40
gb|CP009685.1|  Escherichia coli str. K-12 substr. MG1655, comple...   172    7e-40
gb|CP009789.1|  Escherichia coli K-12 strain ER3413, complete genome   172    7e-40
gb|CP009644.1|  Escherichia coli ER2796, complete genome               172    7e-40
gb|CP009578.1|  Escherichia coli FAP1 genome                           172    7e-40
emb|LM995446.1|  Escherichia coli genome assembly EcRV308Chr ,chr...   172    7e-40
emb|LM993812.1|  Escherichia coli genome assembly EcHMS174Chr ,ch...   172    7e-40
gb|CP009273.1|  Escherichia coli BW25113, complete genome              172    7e-40
emb|LM997267.1|  Escherichia coli genome assembly FHI99, scaffold...   172    7e-40
emb|LM997112.1|  Escherichia coli genome assembly FHI70, scaffold...   172    7e-40
emb|LM996959.1|  Escherichia coli genome assembly FHI85, scaffold...   172    7e-40
emb|LM996837.1|  Escherichia coli genome assembly FHI71, scaffold...   172    7e-40
emb|LM996756.1|  Escherichia coli genome assembly FHI8, scaffold ...   172    7e-40
emb|LM996697.1|  Escherichia coli genome assembly FHI79, scaffold...   172    7e-40
emb|LM996528.1|  Escherichia coli genome assembly FHI65, scaffold...   172    7e-40
emb|LM996494.1|  Escherichia coli genome assembly FHI34, scaffold...   172    7e-40
emb|LM996366.1|  Escherichia coli genome assembly FHI6, scaffold ...   172    7e-40
emb|LM995935.1|  Escherichia coli genome assembly FHI4, scaffold ...   172    7e-40
emb|LM995905.1|  Escherichia coli genome assembly FHI30, scaffold...   172    7e-40
emb|LM995867.1|  Escherichia coli genome assembly FHI29, scaffold...   172    7e-40
emb|LM995830.1|  Escherichia coli genome assembly FHI20, scaffold...   172    7e-40
emb|LM995788.1|  Escherichia coli genome assembly FHI28, scaffold...   172    7e-40
emb|LM995758.1|  Escherichia coli genome assembly FHI24, scaffold...   172    7e-40
emb|LM995705.1|  Escherichia coli genome assembly FHI27, scaffold...   172    7e-40
emb|LK999983.1|  Escherichia coli genome assembly FHI59, scaffold...   172    7e-40
emb|LK999959.1|  Escherichia coli genome assembly FHI42, scaffold...   172    7e-40
emb|LK985432.1|  Escherichia coli genome assembly FHI100, scaffol...   172    7e-40
emb|LM997321.1|  Escherichia coli genome assembly FHI90, scaffold...   172    7e-40
emb|LK931336.1|  Citrobacter koseri genome assembly PRJEB6512_ass...   172    7e-40
gb|CP005998.1|  Escherichia coli B7A, complete genome                  172    7e-40
gb|CP008801.1|  Escherichia coli KLY, complete genome                  172    7e-40
emb|HG738867.1|  Escherichia coli str. K-12 substr. MC4100 comple...   172    7e-40
gb|CP006698.1|  Synthetic Escherichia coli C321.deltaA, complete ...   172    7e-40
gb|U00096.3|  Escherichia coli str. K-12 substr. MG1655, complete...   172    7e-40
gb|CP006584.1|  Escherichia coli LY180, complete genome                172    7e-40
gb|CP002967.1|  Escherichia coli W, complete genome                    172    7e-40
gb|CP002970.1|  Escherichia coli KO11FL, complete genome               172    7e-40
gb|CP002291.1|  Escherichia coli P12b, complete genome                 172    7e-40
dbj|AP012306.1|  Escherichia coli str. K-12 substr. MDS42 DNA, co...   172    7e-40
gb|CP002729.1|  Escherichia coli UMNK88, complete genome               172    7e-40
gb|CP002516.1|  Escherichia coli KO11, complete genome                 172    7e-40
dbj|AP012030.1|  Escherichia coli DH1 (ME8569) DNA, complete genome    172    7e-40
gb|CP002185.1|  Escherichia coli W, complete genome                    172    7e-40
emb|FN649414.1|  Escherichia coli ETEC H10407, complete genome >g...   172    7e-40
gb|CP001637.1|  Escherichia coli DH1, complete genome                  172    7e-40
dbj|AP010960.1|  Escherichia coli O111:H- str. 11128 DNA, complet...   172    7e-40
dbj|AP010953.1|  Escherichia coli O26:H11 str. 11368 DNA, complet...   172    7e-40
gb|CP001396.1|  Escherichia coli BW2952, complete genome               172    7e-40
emb|CU928160.2|  Escherichia coli IAI1 chromosome, complete genome     172    7e-40
dbj|AP009240.1|  Escherichia coli SE11 DNA, complete genome            172    7e-40
gb|CP000948.1|  Escherichia coli str. K12 substr. DH10B, complete...   172    7e-40
gb|CP000822.1|  Citrobacter koseri ATCC BAA-895, complete genome       172    7e-40
gb|CP000800.1|  Escherichia coli E24377A, complete genome              172    7e-40
dbj|AP009048.1|  Escherichia coli str. K12 substr. W3110 DNA, com...   172    7e-40
gb|K00541.1|ECOOMPC  E.coli ompC and micF genes coding for major ...   172    7e-40
emb|X04888.1|  E.coli micF gene for regulatory antisense RNA           172    7e-40
gb|CP012140.1|  Shigella flexneri 4c strain 1205, complete genome      171    2e-39
gb|CP012137.1|  Shigella flexneri 2a strain 981, complete genome       171    2e-39
gb|CP012735.1|  Shigella flexneri 1a strain 0228, complete genome      171    2e-39
gb|CP007037.1|  Shigella flexneri G1663, complete genome               171    2e-39
emb|LM651928.1|  Shigella flexneri genome assembly NCTC1 ,chromos...   171    2e-39
gb|CP004057.1|  Shigella flexneri Shi06HN006, complete genome          171    2e-39
gb|CP004056.1|  Shigella flexneri 2003036, complete genome             171    2e-39
gb|AE005674.2|  Shigella flexneri 2a str. 301, complete genome         171    2e-39
gb|CP001383.1|  Shigella flexneri 2002017, complete genome             171    2e-39
gb|CP000266.1|  Shigella flexneri 5 str. 8401, complete genome         171    2e-39
gb|AE014073.1|  Shigella flexneri 2a str. 2457T, complete genome       171    2e-39
gb|CP000036.1|  Shigella boydii Sb227, complete genome                 171    2e-39
gb|CP015832.1|  Escherichia coli O157 strain 180-PT54, complete g...   167    3e-38
gb|CP015831.1|  Escherichia coli O157 strain 644-PT8, complete ge...   167    3e-38
gb|CP015241.1|  Escherichia coli strain 2013C-4465, complete genome    167    3e-38
gb|CP015240.1|  Escherichia coli strain 2011C-3911, complete genome    167    3e-38
gb|CP011292.1|  Salmonella enterica subsp. diarizonae strain 11-0...   167    3e-38
gb|CP011289.1|  Salmonella enterica subsp. diarizonae strain 11-0...   167    3e-38
gb|CP011288.1|  Salmonella enterica subsp. diarizonae strain 11-0...   167    3e-38
gb|CP015076.1|  Escherichia coli strain Ecol_448, complete genome      167    3e-38
gb|CP015074.1|  Escherichia coli strain Ecol_745, complete genome      167    3e-38
gb|CP015069.1|  Escherichia coli strain Ecol_743, complete genome      167    3e-38
gb|CP015138.1|  Escherichia coli strain Ecol_732, complete genome      167    3e-38
gb|CP015023.1|  Escherichia coli strain SRCC 1675, complete genome     167    3e-38
gb|CP015020.1|  Escherichia coli strain 28RC1, complete genome         167    3e-38
gb|CP011061.1|  Escherichia coli str. Sanji, complete genome           167    3e-38
gb|CP014316.1|  Escherichia coli JJ1887, complete genome               167    3e-38
gb|CP014522.1|  Escherichia coli strain ZH063, complete genome         167    3e-38
gb|CP014497.1|  Escherichia coli strain ZH193, complete genome         167    3e-38
gb|CP014495.1|  Escherichia coli strain SaT040, complete geome         167    3e-38
gb|CP014492.1|  Escherichia coli strain MVAST0167, complete genome     167    3e-38
gb|CP014488.1|  Escherichia coli strain G749, complete genome          167    3e-38
gb|CP014314.1|  Escherichia coli O157:H7 strain JEONG-1266, compl...   167    3e-38
gb|CP014099.1|  Shigella sonnei strain FDAARGOS_90, complete genome    167    3e-38
gb|CP013962.1|  Escherichia coli strain SEC470 genome                  167    3e-38
gb|CP010829.1|  Shigella sonnei strain FORC_011, complete genome       167    3e-38
gb|CP007491.1|  Escherichia coli strain ACN002, complete genome        167    3e-38
gb|CP013837.1|  Escherichia coli strain JJ1897, complete genome        167    3e-38
gb|CP013835.1|  Escherichia coli strain JJ2434, complete genome        167    3e-38
gb|CP013831.1|  Escherichia coli strain CD306, complete genome         167    3e-38
gb|CP013658.1|  Escherichia coli strain uk_P46212, complete sequence   167    3e-38
gb|CP013338.1|  Raoultella ornithinolytica strain Yangling I2, co...   167    3e-38
gb|CP013112.1|  Escherichia coli strain YD786, complete genome         167    3e-38
gb|CP013025.1|  Escherichia coli strain 2009C-3133, complete genome    167    3e-38
gb|CP012802.1|  Escherichia coli O157:H7 strain WS4202, complete ...   167    3e-38
gb|CP012633.1|  Escherichia coli strain SF-166, complete genome        167    3e-38
gb|CP012631.1|  Escherichia coli strain SF-173, complete genome        167    3e-38
gb|CP012635.1|  Escherichia coli strain SF-088, complete genome        167    3e-38
gb|CP012625.1|  Escherichia coli strain SF-468, complete genome        167    3e-38
gb|CP012038.1|  Salmonella enterica subsp. enterica serovar Ouaka...   167    3e-38
gb|CP007442.1|  Escherichia coli ACN001, complete genome               167    3e-38
gb|CP006632.1|  Escherichia coli PCN033, complete genome               167    3e-38
gb|CP011511.1|  Shigella boydii strain ATCC 9210, complete genome      167    3e-38
gb|CP011416.1|  Escherichia coli strain CFSAN029787, complete genome   167    3e-38
gb|CP011331.1|  Escherichia coli O104:H4 str. C227-11, complete g...   167    3e-38
gb|CP011018.1|  Escherichia coli strain CI5, complete genome           167    3e-38
emb|LN831045.1|  Escherichia coli genome assembly NCTC9001, plasm...   167    3e-38
gb|CP007149.1|  Escherichia coli RS218, complete genome                167    3e-38
gb|CP010876.1|  Escherichia coli strain MNCRE44, complete genome       167    3e-38
gb|CP007592.1|  Escherichia coli O157:H16 strain Santai, complete...   167    3e-38
gb|CP010315.1|  Escherichia coli strain 789, complete genome           167    3e-38
emb|HF572917.2|  Escherichia coli HUSEC2011 complete genome            167    3e-38
gb|CP010304.1|  Escherichia coli O157:H7 str. SS52, complete genome    167    3e-38
gb|CP009104.1|  Escherichia coli strain RM9387, complete genome        167    3e-38
gb|CP009859.1|  Escherichia coli strain ECONIH1, complete genome       167    3e-38
emb|LN554916.1|  Escherichia coli genome assembly FHI62, scaffold...   167    3e-38
emb|LM997224.1|  Escherichia coli genome assembly FHI97, scaffold...   167    3e-38
emb|LM997161.1|  Escherichia coli genome assembly FHI92, scaffold...   167    3e-38
emb|LM997077.1|  Escherichia coli genome assembly FHI9, scaffold ...   167    3e-38
emb|LM997039.1|  Escherichia coli genome assembly FHI89, scaffold...   167    3e-38
emb|LM997002.1|  Escherichia coli genome assembly FHI87, scaffold...   167    3e-38
emb|LM996927.1|  Escherichia coli genome assembly FHI83, scaffold...   167    3e-38
emb|LM996867.1|  Escherichia coli genome assembly FHI72, scaffold...   167    3e-38
emb|LM996787.1|  Escherichia coli genome assembly FHI82, scaffold...   167    3e-38
emb|LM996651.1|  Escherichia coli genome assembly FHI75, scaffold...   167    3e-38
emb|LM996610.1|  Escherichia coli genome assembly FHI74, scaffold...   167    3e-38
emb|LM996572.1|  Escherichia coli genome assembly FHI21, scaffold...   167    3e-38
emb|LM996455.1|  Escherichia coli genome assembly FHI63, scaffold...   167    3e-38
emb|LM996319.1|  Escherichia coli genome assembly FHI25, scaffold...   167    3e-38
emb|LM996255.1|  Escherichia coli genome assembly FHI40, scaffold...   167    3e-38
emb|LM996121.1|  Escherichia coli genome assembly FHI14, scaffold...   167    3e-38
emb|LM996078.1|  Escherichia coli genome assembly FHI43, scaffold...   167    3e-38
emb|LM996036.1|  Escherichia coli genome assembly FHI48, scaffold...   167    3e-38
emb|LM995998.1|  Escherichia coli genome assembly FHI58, scaffold...   167    3e-38
emb|LM995659.1|  Escherichia coli genome assembly FHI23, scaffold...   167    3e-38
emb|LM995598.1|  Escherichia coli genome assembly FHI15, scaffold...   167    3e-38
emb|LM995544.1|  Escherichia coli genome assembly FHI12, scaffold...   167    3e-38
emb|LM995511.1|  Escherichia coli genome assembly FHI102, scaffol...   167    3e-38
emb|LM995468.1|  Escherichia coli genome assembly FHI11, scaffold...   167    3e-38
emb|LK931552.1|  Escherichia coli genome assembly StOlav104, scaf...   167    3e-38
emb|LM997396.1|  Escherichia coli genome assembly FHI7, scaffold ...   167    3e-38
emb|LM997368.1|  Escherichia coli genome assembly FHI98, scaffold...   167    3e-38
gb|CP009072.1|  Escherichia coli ATCC 25922, complete genome           167    3e-38
gb|CP008957.1|  Escherichia coli O157:H7 str. EDL933, complete ge...   167    3e-38
gb|CP008805.1|  Escherichia coli O157:H7 str. SS17, complete genome    167    3e-38
emb|LK931502.1|  Salmonella enterica subsp. enterica serovar Dubl...   167    3e-38
gb|CP007799.1|  Escherichia coli Nissle 1917, complete genome          167    3e-38
emb|HG941718.1|  Escherichia coli ST131 strain EC958 chromosome, ...   167    3e-38
gb|CP007136.1|  Escherichia coli O145:H28 str. RM12581, complete ...   167    3e-38
gb|CP007133.1|  Escherichia coli O145:H28 str. RM12761, complete ...   167    3e-38
gb|CP007391.1|  Escherichia coli strain ST540, complete genome         167    3e-38
gb|CP007390.1|  Escherichia coli strain ST540, complete genome         167    3e-38
gb|CP007265.1|  Escherichia coli strain ST540, complete genome         167    3e-38
gb|CP006027.1|  Escherichia coli O145:H28 str. RM13514, complete ...   167    3e-38
gb|CP006262.1|  Escherichia coli O145:H28 str. RM13516, complete ...   167    3e-38
emb|HF969015.2|  Salmonella enterica subsp. enterica serovar Bovi...   167    3e-38
gb|CP006784.1|  Escherichia coli JJ1886, complete genome               167    3e-38
emb|HG428755.1|  Escherichia coli PMV-1 main chromosome, complete...   167    3e-38
gb|CP004142.1|  Raoultella ornithinolytica B6, complete genome         167    3e-38
gb|CP004009.1|  Escherichia coli APEC O78, complete genome             167    3e-38
gb|CP003301.1|  Escherichia coli O104:H4 str. 2009EL-2071, comple...   167    3e-38
gb|CP003289.1|  Escherichia coli O104:H4 str. 2011C-3493, complet...   167    3e-38
gb|CP003297.1|  Escherichia coli O104:H4 str. 2009EL-2050, comple...   167    3e-38
gb|CP001925.1|  Escherichia coli Xuzhou21, complete genome             167    3e-38
gb|CP003109.1|  Escherichia coli O55:H7 str. RM12579, complete ge...   167    3e-38
emb|HE616528.1|  Shigella sonnei 53G main chromosome, complete ge...   167    3e-38
gb|CP002212.1|  Escherichia coli str. 'clone D i14', complete genome   167    3e-38
gb|CP002211.1|  Escherichia coli str. 'clone D i2', complete genome    167    3e-38
gb|CP003034.1|  Escherichia coli O7:K1 str. CE10, complete genome      167    3e-38
gb|CP001855.1|  Escherichia coli O83:H1 str. NRG 857C, complete g...   167    3e-38
gb|CP001671.1|  Escherichia coli ABU 83972, complete genome            167    3e-38
gb|CP001969.1|  Escherichia coli IHE3034, complete genome              167    3e-38
gb|CP001846.1|  Escherichia coli O55:H7 str. CB9615, complete genome   167    3e-38
emb|FN554766.1|  Escherichia coli 042 complete genome                  167    3e-38
dbj|AP009378.1|  Escherichia coli SE15 DNA, complete genome            167    3e-38
dbj|AP010958.1|  Escherichia coli O103:H2 str. 12009 DNA, complet...   167    3e-38
gb|CP001368.1|  Escherichia coli O157:H7 str. TW14359, complete g...   167    3e-38
emb|CU651637.1|  Escherichia coli LF82 chromosome, complete sequence   167    3e-38
emb|CU928163.2|  Escherichia coli UMN026 chromosome, complete genome   167    3e-38
emb|CU928162.2|  Escherichia coli ED1a chromosome, complete genome     167    3e-38
emb|CU928164.2|  Escherichia coli IAI39 chromosome, complete genome    167    3e-38
emb|CU928161.2|  Escherichia coli S88 chromosome, complete genome      167    3e-38
emb|CU928145.2|  Escherichia coli 55989 chromosome, complete genome    167    3e-38
emb|FM180568.1|  Escherichia coli 0127:H6 E2348/69 complete genom...   167    3e-38
gb|CP001164.1|  Escherichia coli O157:H7 str. EC4115, complete ge...   167    3e-38
gb|CP001144.1|  Salmonella enterica subsp. enterica serovar Dubli...   167    3e-38
gb|CP001063.1|  Shigella boydii CDC 3083-94, complete genome           167    3e-38
gb|CP000970.1|  Escherichia coli SMS-3-5, complete genome              167    3e-38
gb|CP000946.1|  Escherichia coli ATCC 8739, complete genome            167    3e-38
gb|CP000802.1|  Escherichia coli HS, complete genome                   167    3e-38
gb|CP000468.1|  Escherichia coli APEC O1, complete genome              167    3e-38
gb|CP000247.1|  Escherichia coli 536, complete genome                  167    3e-38
gb|CP000243.1|  Escherichia coli UTI89, complete genome                167    3e-38
gb|AE014075.1|  Escherichia coli CFT073, complete genome               167    3e-38
dbj|BA000007.2|  Escherichia coli O157:H7 str. Sakai DNA, complet...   167    3e-38
gb|CP000038.1|  Shigella sonnei Ss046, complete genome                 167    3e-38
gb|AE005174.2|  Escherichia coli O157:H7 EDL933, complete genome       167    3e-38
gb|CP014197.1|  Escherichia coli strain MRE600, complete genome        165    1e-37
gb|CP008697.1|  Escherichia coli strain ST648, complete genome         165    1e-37
gb|CP005930.1|  Escherichia coli APEC IMT5155, complete genome         165    1e-37
emb|LM996403.1|  Escherichia coli genome assembly FHI66, scaffold...   165    1e-37
gb|CP007394.1|  Escherichia coli strain ST2747, complete genome        165    1e-37
gb|CP007393.1|  Escherichia coli strain ST2747, complete genome        165    1e-37
gb|CP007392.1|  Escherichia coli strain ST2747, complete genome        165    1e-37
gb|CP002167.1|  Escherichia coli UM146, complete genome                165    1e-37
gb|CP014755.1|  Klebsiella pneumoniae strain AATZP, complete genome    161    1e-36
gb|CP011942.1|  Salmonella enterica subsp. enterica serovar Enter...   161    1e-36
gb|CP015753.1|  Klebsiella pneumoniae strain W14, complete genome      161    1e-36
gb|CP015500.1|  Klebsiella pneumoniae strain SKGH01, complete genome   161    1e-36
gb|CP007584.2|  Salmonella enterica subsp. enterica serovar Anatu...   161    1e-36
gb|CP014979.1|  Salmonella enterica subsp. enterica serovar Typhi...   161    1e-36
gb|CP014977.1|  Salmonella enterica subsp. enterica serovar Typhi...   161    1e-36
gb|CP014975.1|  Salmonella enterica subsp. enterica serovar Typhi...   161    1e-36
gb|CP014971.1|  Salmonella enterica subsp. enterica serovar Typhi...   161    1e-36
gb|CP014969.1|  Salmonella enterica subsp. enterica serovar Typhi...   161    1e-36
gb|CP014967.1|  Salmonella enterica subsp. enterica serovar Typhi...   161    1e-36
gb|CP014965.1|  Salmonella enterica subsp. enterica serovar Typhi...   161    1e-36
gb|CP014983.1|  Salmonella enterica subsp. enterica serovar Typhi...   161    1e-36
gb|CP014982.1|  Salmonella enterica subsp. enterica serovar Typhi...   161    1e-36
gb|CP014981.1|  Salmonella enterica subsp. enterica serovar Typhi...   161    1e-36
gb|CP014666.1|  Salmonella enterica subsp. enterica serovar Anatu...   161    1e-36
gb|CP012985.1|  Salmonella enterica subsp. enterica serovar Typhi...   161    1e-36
gb|CP014994.1|  Salmonella enterica subsp. enterica serovar Tenne...   161    1e-36
gb|CP015024.1|  Salmonella enterica subsp. enterica serovar Agona...   161    1e-36
gb|CP012744.1|  Klebsiella pneumoniae subsp. pneumoniae strain TG...   161    1e-36
gb|CP012743.1|  Klebsiella pneumoniae subsp. pneumoniae strain TG...   161    1e-36
gb|CP014696.1|  Klebsiella quasipneumoniae strain ATCC 700603, co...   161    1e-36
gb|CP014748.1|  Enterobacter aerogenes strain FDAARGOS_139, compl...   161    1e-36
gb|CP011233.1|  Salmonella enterica subsp. enterica serovar Typhi...   161    1e-36
gb|CP014358.1|  Salmonella enterica subsp. enterica serovar Typhi...   161    1e-36
gb|CP014356.1|  Salmonella enterica subsp. enterica serovar Typhi...   161    1e-36
gb|CP014536.1|  Salmonella enterica subsp. enterica serovar Typhi...   161    1e-36
gb|CP011539.1|  Enterobacter aerogenes strain G7, complete genome      161    1e-36
gb|CP014029.1|  Enterobacter aerogenes strain FDAARGOS_152, compl...   161    1e-36
gb|CP014051.1|  Salmonella enterica strain LT2, complete genome        161    1e-36
emb|LN999997.1|  Salmonella enterica subsp. enterica serovar Typh...   161    1e-36
gb|CP014010.1|  Klebsiella pneumoniae subsp. pneumoniae strain RJ...   161    1e-36
gb|CP014008.1|  Klebsiella pneumoniae subsp. pneumoniae strain RJ...   161    1e-36
gb|CP014004.1|  Klebsiella pneumoniae subsp. pneumoniae strain NU...   161    1e-36
gb|AE006468.2|  Salmonella enterica subsp. enterica serovar Typhi...   161    1e-36
gb|CP013097.1|  Salmonella enterica subsp. enterica serovar Enter...   161    1e-36
gb|CP013711.1|  Klebsiella pneumoniae strain J1, complete genome       161    1e-36
gb|CP012043.1|  Klebsiella pneumoniae strain U25 genome                161    1e-36
gb|CP013322.1|  Klebsiella pneumoniae strain CAV1193, complete ge...   161    1e-36
gb|CP012992.1|  Klebsiella pneumoniae strain KpN06, complete genome    161    1e-36
gb|CP012987.1|  Klebsiella pneumoniae strain KpN01, complete genome    161    1e-36
emb|LN824133.1|  Klebsiella pneumoniae genome assembly MS6671.v1,...   161    1e-36
gb|CP012144.1|  Salmonella enterica subsp. enterica serovar Typhi...   161    1e-36
gb|CP012930.1|  Salmonella enterica subsp. enterica serovar Heide...   161    1e-36
gb|CP012924.1|  Salmonella enterica subsp. enterica serovar Heide...   161    1e-36
gb|CP012921.1|  Salmonella enterica subsp. enterica serovar Heide...   161    1e-36
gb|CP012883.1|  Klebsiella pneumoniae KP-1, complete genome            161    1e-36
gb|CP012833.1|  Salmonella enterica subsp. enterica serovar Cerro...   161    1e-36
gb|CP012753.1|  Klebsiella pneumoniae strain KP617, complete genome    161    1e-36
gb|CP012514.1|  Salmonella enterica subsp. enterica serovar Thomp...   161    1e-36
gb|CP012513.1|  Salmonella enterica subsp. enterica serovar Thomp...   161    1e-36
gb|CP012681.1|  Salmonella enterica subsp. enterica serovar Typhi...   161    1e-36
dbj|AP014951.1|  Klebsiella oxytoca DNA, complete genome, strain:...   161    1e-36
dbj|AP014950.1|  Klebsiella pneumoniae DNA, complete genome, stra...   161    1e-36
gb|CP012300.1|  Klebsiella pneumoniae subsp. pneumoniae strain HK...   161    1e-36
gb|CP012252.1|  Klebsiella variicola strain HKUOPLA, complete genome   161    1e-36
gb|CP012349.1|  Salmonella enterica subsp. enterica serovar Slote...   161    1e-36
gb|CP012347.1|  Salmonella enterica subsp. enterica serovar Pullo...   161    1e-36
gb|CP012344.1|  Salmonella enterica subsp. enterica serovar Chole...   161    1e-36
gb|CP007267.2|  Salmonella enterica subsp. enterica serovar Enter...   161    1e-36
gb|CP007329.2|  Salmonella enterica subsp. enterica serovar Enter...   161    1e-36
gb|CP007249.2|  Salmonella enterica subsp. enterica serovar Enter...   161    1e-36
emb|LN868943.1|  Salmonella enterica subsp. enterica serovar Senf...   161    1e-36
gb|CP011636.1|  Klebsiella oxytoca strain CAV1374, complete genome     161    1e-36
gb|CP011624.1|  Klebsiella pneumoniae strain CAV1344, complete ge...   161    1e-36
gb|CP011618.1|  Klebsiella oxytoca strain CAV1335, complete genome     161    1e-36
gb|CP011597.1|  Klebsiella oxytoca strain CAV1099, complete genome     161    1e-36
gb|CP011574.1|  Enterobacter aerogenes strain CAV1320, complete g...   161    1e-36
gb|CP011428.1|  Salmonella enterica subsp. enterica strain YU39, ...   161    1e-36
gb|CP011421.1|  Klebsiella pneumoniae strain yzusk-4 genome            161    1e-36
gb|CP011396.1|  Salmonella enterica subsp. enterica serovar Thomp...   161    1e-36
gb|CP011365.1|  Salmonella enterica subsp. enterica serovar Typhi...   161    1e-36
gb|CP011313.1|  Klebsiella pneumoniae subsp. pneumoniae strain 23...   161    1e-36
gb|CP007559.1|  Salmonella enterica subsp. enterica serovar Newpo...   161    1e-36
gb|CP007540.1|  Salmonella enterica subsp. enterica serovar Monte...   161    1e-36
gb|CP007523.1|  Salmonella enterica subsp. enterica serovar Typhi...   161    1e-36
gb|CP011259.1|  Salmonella enterica subsp. enterica serovar Agona...   161    1e-36
emb|LN829401.1|  Salmonella enterica subsp. enterica serovar Typh...   161    1e-36
gb|CP010283.1|  Salmonella enterica subsp. enterica serovar Newpo...   161    1e-36
gb|CP010282.1|  Salmonella enterica subsp. enterica serovar Newpo...   161    1e-36
gb|CP010281.1|  Salmonella enterica subsp. enterica serovar Newpo...   161    1e-36
gb|CP010279.1|  Salmonella enterica subsp. enterica serovar Newpo...   161    1e-36
gb|CP010284.1|  Salmonella enterica subsp. enterica serovar Newpo...   161    1e-36
gb|CP007235.1|  Salmonella enterica subsp. enterica serovar Typhi...   161    1e-36
gb|CP007222.1|  Salmonella enterica subsp. enterica serovar Monte...   161    1e-36
gb|CP007216.1|  Salmonella enterica subsp. enterica serovar Newpo...   161    1e-36
gb|CP007211.1|  Salmonella enterica subsp. enterica serovar Anatu...   161    1e-36
gb|CP009084.2|  Salmonella enterica subsp. enterica serovar Enter...   161    1e-36
gb|CP009085.2|  Salmonella enterica subsp. enterica serovar Enter...   161    1e-36
gb|CP010523.1|  Klebsiella variicola strain DSM 15968, complete g...   161    1e-36
gb|CP010280.1|  Salmonella enterica subsp. enterica serovar Newpo...   161    1e-36
gb|CP006722.1|  Klebsiella pneumoniae subsp. pneumoniae 1158, com...   161    1e-36
gb|CP009274.1|  Klebsiella variicola strain DX120E, complete genome    161    1e-36
emb|LN649235.1|  Salmonella enterica subsp. enterica serovar Infa...   161    1e-36
gb|CP009876.1|  Klebsiella pneumoniae subsp. pneumoniae strain KP...   161    1e-36
gb|CP009863.1|  Klebsiella pneumoniae subsp. pneumoniae strain KP...   161    1e-36
gb|CP009461.1|  Klebsiella pneumoniae strain XH209, complete genome    161    1e-36
gb|CP009565.1|  Salmonella enterica subsp. enterica serovar Newpo...   161    1e-36
gb|CP009561.1|  Salmonella enterica subsp. enterica serovar Newpo...   161    1e-36
gb|CP008929.1|  Klebsiella pneumoniae strain PMK1, complete genome     161    1e-36
gb|CP008928.1|  Salmonella enterica subsp. enterica serovar Enter...   161    1e-36
gb|CP009088.1|  Salmonella enterica subsp. enterica serovar Enter...   161    1e-36
gb|CP009083.1|  Salmonella enterica subsp. enterica serovar Enter...   161    1e-36
gb|CP009087.1|  Salmonella enterica subsp. enterica serovar Enter...   161    1e-36
gb|CP009086.1|  Salmonella enterica subsp. enterica serovar Enter...   161    1e-36
gb|CP009093.1|  Salmonella enterica subsp. enterica serovar Enter...   161    1e-36
gb|CP009092.1|  Salmonella enterica subsp. enterica serovar Enter...   161    1e-36
gb|CP009091.1|  Salmonella enterica subsp. enterica serovar Enter...   161    1e-36
gb|CP009089.1|  Salmonella enterica subsp. enterica serovar Enter...   161    1e-36
gb|CP007639.1|  Salmonella enterica subsp. enterica serovar Chole...   161    1e-36
gb|CP009208.1|  Klebsiella pneumoniae subsp. pneumoniae strain AT...   161    1e-36
gb|CP007804.2|  Salmonella enterica subsp. enterica serovar Typhi...   161    1e-36
gb|CP006798.1|  Klebsiella pneumoniae subsp. pneumoniae PittNDM01...   161    1e-36
gb|CP008841.1|  Klebsiella oxytoca strain M1, complete genome          161    1e-36
emb|LK931482.1|  Salmonella enterica subsp. enterica serovar Pull...   161    1e-36
dbj|AP014565.1|  Salmonella enterica subsp. enterica serovar Typh...   161    1e-36
gb|CP008788.1|  Klebsiella oxytoca KONIH1, complete genome             161    1e-36
gb|CP008700.1|  Klebsiella pneumoniae subsp. pneumoniae KP5-1, co...   161    1e-36
gb|CP006692.1|  Salmonella bongori serovar 48:z41:-- str. RKS3044...   161    1e-36
gb|CP007731.1|  Klebsiella pneumoniae subsp. pneumoniae KPNIH27, ...   161    1e-36
gb|CP007598.1|  Salmonella enterica subsp. enterica serovar Enter...   161    1e-36
gb|CP007581.1|  Salmonella enterica subsp. enterica serovar Typhi...   161    1e-36
gb|CP004887.1|  Klebsiella oxytoca HKOPL1, complete genome             161    1e-36
gb|CP007528.1|  Salmonella enterica subsp. enterica serovar Enter...   161    1e-36
gb|CP007534.1|  Salmonella enterica subsp. enterica serovar Abony...   161    1e-36
gb|CP007533.1|  Salmonella enterica subsp. enterica serovar Brede...   161    1e-36
gb|CP007532.1|  Salmonella enterica subsp. enterica serovar Abaet...   161    1e-36
gb|CP007531.1|  Salmonella enterica subsp. enterica serovar Anatu...   161    1e-36
gb|CP007530.1|  Salmonella enterica subsp. enterica serovar Monte...   161    1e-36
gb|CP007507.1|  Salmonella enterica subsp. enterica serovar Enter...   161    1e-36
gb|CP007248.1|  Salmonella enterica subsp. enterica serovar Enter...   161    1e-36
gb|CP007247.1|  Salmonella enterica subsp. enterica serovar Enter...   161    1e-36
gb|CP007246.1|  Salmonella enterica subsp. enterica serovar Enter...   161    1e-36
gb|CP007245.1|  Salmonella enterica subsp. enterica serovar Enter...   161    1e-36
gb|CP007175.1|  Salmonella enterica subsp. enterica serovar Enter...   161    1e-36
gb|CP007253.1|  Salmonella enterica subsp. enterica serovar Enter...   161    1e-36
gb|CP007252.1|  Salmonella enterica subsp. enterica serovar Enter...   161    1e-36
gb|CP007251.1|  Salmonella enterica subsp. enterica serovar Enter...   161    1e-36
gb|CP007250.1|  Salmonella enterica subsp. enterica serovar Enter...   161    1e-36
gb|CP007254.1|  Salmonella enterica subsp. enterica serovar Enter...   161    1e-36
gb|CP007332.1|  Salmonella enterica subsp. enterica serovar Enter...   161    1e-36
gb|CP007262.1|  Salmonella enterica subsp. enterica serovar Enter...   161    1e-36
gb|CP007261.1|  Salmonella enterica subsp. enterica serovar Enter...   161    1e-36
gb|CP007260.1|  Salmonella enterica subsp. enterica serovar Enter...   161    1e-36
gb|CP007259.1|  Salmonella enterica subsp. enterica serovar Enter...   161    1e-36
gb|CP007258.1|  Salmonella enterica subsp. enterica serovar Enter...   161    1e-36
gb|CP007263.1|  Salmonella enterica subsp. enterica serovar Enter...   161    1e-36
gb|CP007505.1|  Salmonella enterica subsp. enterica serovar Tenne...   161    1e-36
emb|FO834906.1|  Klebsiella pneumoniae str. Kp52.145, chromosome,...   161    1e-36
gb|CP003999.1|  Klebsiella pneumoniae subsp. pneumoniae Kp13, com...   161    1e-36
gb|CP005995.1|  Salmonella enterica subsp. enterica serovar Heide...   161    1e-36
gb|CP006876.1|  Salmonella enterica subsp. enterica serovar Agona...   161    1e-36
gb|CP005390.2|  Salmonella enterica subsp. enterica serovar Heide...   161    1e-36
emb|HG326213.1|  Salmonella enterica subsp. enterica serovar Typh...   161    1e-36
gb|CP006717.1|  Salmonella enterica subsp. enterica serovar Thomp...   161    1e-36
emb|HF937208.1|  Salmonella enterica subsp. enterica serovar Typh...   161    1e-36
gb|CP003786.1|  Salmonella enterica subsp. enterica serovar Galli...   161    1e-36
gb|CP006575.1|  Salmonella enterica subsp. enterica serovar Pullo...   161    1e-36
gb|CP006631.1|  Salmonella enterica subsp. enterica serovar Newpo...   161    1e-36
gb|CP006608.1|  Salmonella bongori N268-08, complete genome            161    1e-36
gb|CP006602.1|  Salmonella enterica subsp. enterica serovar Typhi...   161    1e-36
gb|CP006055.1|  Salmonella enterica subsp. enterica Serovar Cuban...   161    1e-36
gb|CP006053.1|  Salmonella enterica subsp. enterica serovar Barei...   161    1e-36
gb|CP006048.1|  Salmonella enterica subsp. enterica serovar Typhi...   161    1e-36
gb|CP004086.1|  Salmonella enterica subsp. enterica serovar Heide...   161    1e-36
emb|FO203501.1|  Klebsiella pneumoniae subsp. rhinoscleromatis st...   161    1e-36
gb|CP003836.1|  Salmonella enterica subsp. enterica serovar Typhi...   161    1e-36
gb|CP004027.1|  Salmonella enterica subsp. enterica serovar Javia...   161    1e-36
emb|FO203355.1|  Enterobacter aerogenes EA1509E complete genome        161    1e-36
gb|CP003683.1|  Klebsiella oxytoca E718, complete genome               161    1e-36
gb|CP003416.1|  Salmonella enterica subsp. enterica serovar Heide...   161    1e-36
gb|CP003386.1|  Salmonella enterica subsp. enterica serovar Typhi...   161    1e-36
gb|CP003218.1|  Klebsiella oxytoca KCTC 1686, complete genome          161    1e-36
gb|CP003047.1|  Salmonella enterica subsp. enterica serovar Galli...   161    1e-36
gb|CP002910.1|  Klebsiella pneumoniae KCTC 2242, complete genome       161    1e-36
emb|FR877557.1|  Salmonella bongori NCTC 12419, culture collectio...   161    1e-36
gb|CP002824.1|  Enterobacter aerogenes KCTC 2190, complete genome      161    1e-36
gb|CP002614.1|  Salmonella enterica subsp. enterica serovar Typhi...   161    1e-36
gb|GU461279.1|  Klebsiella pneumoniae strain NVT2001 putative 2-c...   161    1e-36
gb|CP002487.1|  Salmonella enterica subsp. enterica serovar Typhi...   161    1e-36
dbj|AP011957.1|  Salmonella enterica subsp. enterica serovar Typh...   161    1e-36
emb|FQ312003.1|  Salmonella enterica subsp. enterica serovar Typh...   161    1e-36
gb|CP001891.1|  Klebsiella variicola At-22, complete genome            161    1e-36
gb|CP001363.1|  Salmonella enterica subsp. enterica serovar Typhi...   161    1e-36
emb|FN424405.1|  Salmonella enterica subsp. enterica serovar Typh...   161    1e-36
dbj|AP006725.1|  Klebsiella pneumoniae subsp. pneumoniae NTUH-K20...   161    1e-36
gb|CP000964.1|  Klebsiella pneumoniae 342, complete genome             161    1e-36
gb|EF191076.2|  Enterobacter aerogenes strain C1 OmpE36 (ompE36) ...   161    1e-36
emb|AM933173.1|  Salmonella enterica subsp. enterica serovar Gall...   161    1e-36
gb|CP001138.1|  Salmonella enterica subsp. enterica serovar Agona...   161    1e-36
gb|CP001127.1|  Salmonella enterica subsp. enterica serovar Schwa...   161    1e-36
gb|CP001120.1|  Salmonella enterica subsp. enterica serovar Heide...   161    1e-36
gb|CP001113.1|  Salmonella enterica subsp. enterica serovar Newpo...   161    1e-36
gb|CP000886.1|  Salmonella enterica subsp. enterica serovar Parat...   161    1e-36
gb|CP000647.1|  Klebsiella pneumoniae subsp. pneumoniae MGH 78578...   161    1e-36
gb|S75172.1|  ompC=outer membrane protein C, micF=regulatory RNA ...   161    1e-36
gb|AE017220.1|  Salmonella enterica subsp. enterica serovar Chole...   161    1e-36
gb|AF039309.1|AF039309  Salmonella typhimurium outer membrane por...   161    1e-36
emb|LT216436.1|  Klebsiella pneumoniae isolate 207M1D0-sc-2013-04...   159    5e-36
gb|CP007468.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007323.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007339.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007344.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007378.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007412.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007425.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007325.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007498.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007469.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007467.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007466.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007464.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007463.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007438.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007433.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007429.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007428.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007427.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007432.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007431.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007430.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007426.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007404.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007401.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007368.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007367.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007366.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007373.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007372.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007371.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007370.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007369.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007422.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007421.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007420.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007434.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007424.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007423.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007419.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007418.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007417.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007416.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007415.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007354.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007361.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007359.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007358.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007357.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007382.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007381.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007380.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007379.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007377.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007376.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007365.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007311.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007310.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007309.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007308.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007307.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007334.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007333.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007364.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007363.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007362.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007396.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007374.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007375.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007405.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007360.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007353.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007352.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007351.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007350.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007349.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007348.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007347.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007346.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007345.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007340.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007338.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007336.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007335.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007328.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007326.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007324.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007319.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007314.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007313.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007312.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007306.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007305.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007304.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007303.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007302.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007356.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007355.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007298.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007297.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007296.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007286.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007285.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007283.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007291.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007290.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007289.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007288.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007277.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007295.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007294.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007293.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007292.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007282.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007281.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007280.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007279.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007278.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007301.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007300.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007274.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007273.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007272.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007271.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007270.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007414.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007413.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007411.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007284.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007266.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007408.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007407.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007406.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007403.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007402.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007400.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007398.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007397.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007395.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007388.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007387.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007386.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007385.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007384.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007383.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007343.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007342.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007341.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007331.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007330.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007327.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007322.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007321.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007320.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007318.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007317.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007316.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007315.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP007337.2|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP006659.2|  Klebsiella pneumoniae strain ATCC BAA-2146 chromo...   159    5e-36
gb|CP009768.1|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP012151.1|  Salmonella enterica subsp. enterica serovar Typhi...   159    5e-36
gb|CP012091.1|  Salmonella enterica subsp. enterica serovar Typhi...   159    5e-36
gb|CP011989.1|  Klebsiella pneumoniae UHKPC33, complete genome         159    5e-36
gb|CP011985.1|  Klebsiella pneumoniae UHKPC07, complete genome         159    5e-36
gb|CP011976.1|  Klebsiella pneumoniae DMC1097, complete genome         159    5e-36
gb|CP011980.1|  Klebsiella pneumoniae 500_1420, complete genome        159    5e-36
gb|CP011791.1|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP011790.1|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP011647.1|  Klebsiella pneumoniae strain CAV1596, complete ge...   159    5e-36
gb|CP011578.1|  Klebsiella pneumoniae strain CAV1392, complete ge...   159    5e-36
gb|CP011394.1|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP010361.1|  Klebsiella pneumoniae strain 32192, complete genome    159    5e-36
gb|CP010392.1|  Klebsiella pneumoniae strain 34618, complete genome    159    5e-36
gb|CP009872.1|  Klebsiella pneumoniae subsp. pneumoniae strain KP...   159    5e-36
gb|CP009775.1|  Klebsiella pneumoniae subsp. pneumoniae strain KP...   159    5e-36
gb|CP009771.1|  Klebsiella pneumoniae subsp. pneumoniae strain KP...   159    5e-36
gb|CP009090.1|  Salmonella enterica subsp. enterica serovar Enter...   159    5e-36
gb|CP009102.1|  Salmonella enterica subsp. enterica serovar Typhi...   159    5e-36
gb|CP009114.1|  Klebsiella pneumoniae strain blaNDM-1, complete g...   159    5e-36
gb|CP008831.1|  Klebsiella pneumoniae subsp. pneumoniae KPR0928, ...   159    5e-36
gb|CP008827.1|  Klebsiella pneumoniae subsp. pneumoniae KPNIH1, c...   159    5e-36
gb|CP008797.1|  Klebsiella pneumoniae subsp. pneumoniae KPNIH24, ...   159    5e-36
gb|CP007727.1|  Klebsiella pneumoniae subsp. pneumoniae KPNIH10, ...   159    5e-36
gb|CP006923.1|  Klebsiella pneumoniae 30660/NJST258_1, complete g...   159    5e-36
gb|CP006918.1|  Klebsiella pneumoniae 30684/NJST258_2, complete g...   159    5e-36
gb|CP006656.1|  Klebsiella pneumoniae JM45, complete genome            159    5e-36
emb|AL513382.1|  Salmonella enterica subsp. enterica serovar Typh...   159    5e-36
gb|CP003785.1|  Klebsiella pneumoniae subsp. pneumoniae 1084, com...   159    5e-36
gb|CP003278.1|  Salmonella enterica subsp. enterica serovar Typhi...   159    5e-36
gb|CP003200.1|  Klebsiella pneumoniae subsp. pneumoniae HS11286, ...   159    5e-36
gb|CP000857.1|  Salmonella enterica subsp. enterica serovar Parat...   159    5e-36
emb|AM933172.1|  Salmonella enterica subsp. enterica serovar Ente...   159    5e-36
gb|AE014613.1|  Salmonella enterica subsp. enterica serovar Typhi...   159    5e-36
emb|LT571437.1|  Salmonella enterica subsp. enterica serovar Java...   156    7e-35
gb|CP015724.1|  Salmonella enterica strain C629, complete genome       156    7e-35
gb|CP014665.1|  Salmonella enterica subsp. enterica serovar Anatu...   156    7e-35
gb|CP014664.1|  Salmonella enterica subsp. enterica serovar Anatu...   156    7e-35
gb|CP014663.1|  Salmonella enterica subsp. enterica serovar Anatu...   156    7e-35
gb|CP014661.1|  Salmonella enterica subsp. enterica serovar Anatu...   156    7e-35
gb|CP014659.1|  Salmonella enterica subsp. enterica serovar Anatu...   156    7e-35
gb|CP014657.1|  Salmonella enterica subsp. enterica serovar Anatu...   156    7e-35
gb|CP014621.1|  Salmonella enterica subsp. enterica serovar Anatu...   156    7e-35
gb|CP014620.1|  Salmonella enterica subsp. enterica serovar Anatu...   156    7e-35
gb|CP014996.1|  Salmonella enterica subsp. enterica serovar Welte...   156    7e-35
gb|CP013226.1|  Salmonella enterica subsp. enterica serovar Anatu...   156    7e-35
gb|CP013222.1|  Salmonella enterica subsp. enterica serovar Anatu...   156    7e-35
emb|LN890524.1|  Salmonella enterica subsp. enterica serovar Welt...   156    7e-35
emb|LN890522.1|  Salmonella enterica subsp. enterica serovar Welt...   156    7e-35
emb|LN890520.1|  Salmonella enterica subsp. enterica serovar Welt...   156    7e-35
emb|LN890518.1|  Salmonella enterica subsp. enterica serovar Welt...   156    7e-35
gb|CP012346.1|  Salmonella enterica subsp. enterica serovar Panam...   156    7e-35
gb|CP011967.1|  Salmonella enterica subsp. enterica serovar Parat...   156    7e-35
gb|CP007483.1|  Salmonella enterica subsp. enterica serovar Anatu...   156    7e-35
gb|CP009049.1|  Salmonella enterica subsp. enterica serovar Parat...   156    7e-35
gb|CP009559.1|  Salmonella enterica subsp. enterica serovar Parat...   156    7e-35
gb|CP006738.1|  Klebsiella pneumoniae HK787, complete genome           156    7e-35
gb|CP006693.1|  Salmonella enterica subsp. arizonae serovar 62:z3...   156    7e-35
gb|CP006648.1|  Klebsiella pneumoniae CG43, complete genome            156    7e-35
emb|FR775224.1|  Salmonella enterica subsp. enterica serovar Welt...   156    7e-35
emb|FM200053.1|  Salmonella enterica subsp. enterica serovar Para...   156    7e-35
gb|CP000880.1|  Salmonella enterica subsp. arizonae serovar 62:z4...   156    7e-35
gb|CP000026.1|  Salmonella enterica subsp. enterica serovar Parat...   156    7e-35
gb|CP000034.1|  Shigella dysenteriae Sd197, complete genome            156    7e-35
gb|CP007465.1|  Salmonella enterica subsp. enterica serovar Enter...   154    2e-34
gb|CP002099.1|  Salmonella enterica subsp. enterica serovar Typhi...   154    2e-34
gb|CP010557.1|  Raoultella ornithinolytica strain S12, complete g...   150    3e-33
gb|CP003938.1|  Enterobacteriaceae bacterium strain FGI 57, compl...   150    3e-33
gb|CP002272.1|  Enterobacter lignolyticus SCF1, complete genome        150    3e-33
emb|Z33506.1|  K.pneumoniae (C3) ompK36 gene for OmpK36 porin and...   150    3e-33
emb|Y15844.1|  Salmonella minnesota ompC gene                          148    1e-32
gb|CP014015.1|  Citrobacter amalonaticus strain FDAARGOS_122, com...   145    1e-31
gb|CP014070.1|  Citrobacter amalonaticus strain FDAARGOS_165, com...   145    1e-31
gb|CP012871.1|  Klebsiella sp. G5, complete genome                     145    1e-31
dbj|AP014857.1|  Escherichia albertii DNA, complete genome, strai...   145    1e-31
dbj|AP014856.1|  Escherichia albertii DNA, complete genome, strai...   145    1e-31
dbj|AP014855.1|  Escherichia albertii DNA, complete genome, strai...   145    1e-31
gb|CP012167.1|  Enterobacter cloacae strain 34998, complete genome     145    1e-31
gb|CP012165.1|  Enterobacter cloacae strain 34978, complete genome     145    1e-31
gb|CP010376.2|  Enterobacter cloacae strain 34977, complete genome     145    1e-31
gb|CP011650.1|  Enterobacter cloacae strain CAV1669, complete genome   145    1e-31
gb|CP011584.1|  Enterobacter cloacae strain CAV1668, complete genome   145    1e-31
gb|CP011581.1|  Enterobacter cloacae strain CAV1411, complete genome   145    1e-31
gb|CP011572.1|  Enterobacter cloacae strain CAV1311, complete genome   145    1e-31
gb|CP011132.1|  Citrobacter amalonaticus Y19, complete genome          145    1e-31
gb|CP010384.1|  Enterobacter cloacae strain 34399, complete genome     145    1e-31
gb|CP008823.1|  Enterobacter cloacae ECNIH2, complete genome           145    1e-31
gb|CP007025.1|  Escherichia albertii KF1, complete genome              145    1e-31
emb|FP929040.1|  Enterobacter cloacae subsp. cloacae NCTC 9394 dr...   145    1e-31
emb|CU928158.2|  Escherichia fergusonii ATCC 35469 chromosome, co...   145    1e-31
gb|CP014280.1|  Enterobacter cloacae isolate MBRL1077 genome           139    7e-30
gb|CP014030.1|  Citrobacter sp. FDAARGOS_156, complete genome          139    7e-30
gb|CP012999.1|  Enterobacter sp. E20, complete genome                  139    7e-30
gb|CP011657.1|  Citrobacter freundii strain CAV1741, complete genome   139    7e-30
gb|CP011612.1|  Citrobacter freundii strain CAV1321, complete genome   139    7e-30
gb|CP010377.1|  Enterobacter cloacae strain 34983, complete genome     139    7e-30
gb|CP009854.1|  Enterobacter cloacae strain ECNIH5, complete genome    139    7e-30
gb|CP009756.1|  Enterobacter cloacae strain GGT036, complete genome    139    7e-30
gb|CP008905.1|  Enterobacter cloacae ECR091, complete genome           139    7e-30
gb|CP008897.1|  Enterobacter cloacae ECNIH3, complete genome           139    7e-30
gb|CP007557.1|  Citrobacter freundii CFNIH1, complete genome           139    7e-30
gb|CP003678.1|  Enterobacter cloacae subsp. dissolvens SDM, compl...   139    7e-30
gb|CP001918.1|  Enterobacter cloacae subsp. cloacae ATCC 13047, c...   139    7e-30
gb|CP010512.1|  Enterobacter cloacae strain colR/S, complete genome    134    3e-28
gb|CP011863.1|  Enterobacter asburiae strain ATCC 35953, complete...   134    3e-28
gb|CP012162.1|  Enterobacter asburiae strain 35734, complete genome    134    3e-28
gb|CP011602.1|  Kluyvera intermedia strain CAV1151, complete genome    134    3e-28
gb|CP011591.1|  Enterobacter asburiae strain CAV1043, complete ge...   134    3e-28
gb|CP007546.1|  Enterobacter asburiae L1, complete genome              134    3e-28
gb|CP005991.1|  Enterobacter sp. R4-368, complete genome               134    3e-28
gb|CP012554.1|  Citrobacter freundii strain P10159, complete genome    130    4e-27
gb|CP015227.1|  Enterobacter sp. ODB01, complete genome                128    1e-26
gb|CP014993.1|  Enterobacter asburiae strain ENIPBJ-CG1, complete...   128    1e-26
gb|CP012487.1|  Enterobacter sp. FY-07, complete genome                128    1e-26
gb|CP011798.1|  Enterobacter cloacae strain UW5, complete genome       128    1e-26
gb|CP009850.1|  Enterobacter cloacae strain ECNIH4, complete genome    128    1e-26
gb|CP009450.1|  Pluralibacter gergoviae strain FB2, complete genome    128    1e-26
gb|CP007215.2|  Enterobacter sacchari SP1, complete genome             128    1e-26
gb|CP006580.1|  Enterobacter cloacae P101, complete genome             128    1e-26
gb|CP003737.1|  Enterobacter cloacae subsp. cloacae ENHKU01, comp...   128    1e-26
gb|CP002886.1|  Enterobacter cloacae EcWSU1, complete genome           128    1e-26
gb|CP003026.1|  Enterobacter asburiae LF7a, complete genome            128    1e-26
emb|FN543502.1|  Citrobacter rodentium ICC168, complete genome         128    1e-26
gb|M31424.1|STYOMPC  S.typhi outer membrane protein (ompC) gene, ...   124    2e-25
gb|CP000653.1|  Enterobacter sp. 638, complete genome                  117    3e-23
gb|CP011077.1|  Klebsiella michiganensis strain RC10, complete ge...   115    1e-22
gb|CP009459.1|  Cedecea neteri strain ND14a, complete genome           115    1e-22
gb|CP009458.1|  Cedecea neteri strain M006, complete genome            115    1e-22
gb|CP009451.1|  Cedecea neteri strain SSMD04, complete genome          115    1e-22
gb|CP013990.1|  Leclercia adecarboxylata strain USDA-ARS-USMARC-6...   111    1e-21
gb|CP012264.1|  Cronobacter condimenti 1330 strain LMG 26250, com...   111    1e-21
gb|CP012266.1|  Cronobacter dublinensis subsp. dublinensis LMG 23...   108    2e-20
emb|FN543093.2|  Cronobacter turicensis z3032 complete genome          108    2e-20
gb|CP013940.1|  Cronobacter malonaticus LMG 23826, complete genome     106    7e-20
gb|CP012268.1|  Cronobacter muytjensii ATCC 51329, complete genome     106    7e-20
gb|CP012257.1|  Cronobacter universalis NCTC 9529, complete genome     106    7e-20
gb|CP012253.1|  Cronobacter sakazakii strain NCTC 8155, complete ...   106    7e-20
gb|CP011047.1|  Cronobacter sakazakii strain ATCC 29544, complete...   106    7e-20
gb|CP006731.1|  Cronobacter sakazakii CMCC 45402, complete genome      106    7e-20
gb|CP004091.1|  Cronobacter sakazakii SP291, complete genome           106    7e-20
gb|CP003312.1|  Cronobacter sakazakii ES15, complete genome            106    7e-20
gb|CP000783.1|  Cronobacter sakazakii ATCC BAA-894, complete genome    106    7e-20
gb|JX291114.1|  Klebsiella pneumoniae strain HS062105 OmpK36 pori...  93.5    5e-16
gb|JX310557.1|  Klebsiella pneumoniae strain HS08763 Ompk36 (ompk...  93.5    5e-16
gb|JX310552.1|  Klebsiella pneumoniae strain HS092187 Ompk36 (omp...  93.5    5e-16
gb|JX310551.1|  Klebsiella pneumoniae strain HS082847 Ompk36 (omp...  93.5    5e-16
gb|JX310550.1|  Klebsiella pneumoniae strain HS082416 Ompk36 (omp...  93.5    5e-16


>gb|CP014348.1| Escherichia coli str. K-12 substr. MG1655 strain JW5437-1, complete 
genome
Length=4657541

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3021806  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  3021747

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  3021746  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  3021714


>gb|CP014092.1| Escherichia coli strain 268-78-1, complete genome
Length=5363962

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4842421  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  4842362

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  4842361  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  4842329


>gb|CP014272.1| Escherichia coli K-12 strain C3026, complete genome
Length=4745255

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2415230  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2415289

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2415290  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2415322


>gb|CP014270.1| Escherichia coli K-12 strain DHB4, complete genome
Length=4546849

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2216161  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2216220

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2216221  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2216253


>gb|CP014225.1| Escherichia coli str. K-12 substr. MG1655, complete genome
Length=4659625

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  510284  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  510343

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               |||||||||||||||||||||||||||||||||
Sbjct  510344  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  510376


>gb|CP013253.1| Escherichia coli strain CQSW20, complete genome
Length=4579074

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1102453  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  1102394

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  1102393  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  1102361


>gb|CP013048.1| Escherichia coli strain RS76 genome
Length=4689408

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1930786  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  1930727

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  1930726  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  1930694


>gb|CP013029.1| Escherichia coli strain 2012C-4227, complete genome
Length=5202850

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3238898  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  3238957

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  3238958  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  3238990


>gb|CP011343.2| Escherichia coli K-12 GM4792 Lac-, complete genome
Length=4621656

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2293542  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2293601

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2293602  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2293634


>gb|CP011342.2| Escherichia coli K-12 GM4792 Lac+, complete genome
Length=4622342

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2294372  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2294431

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2294432  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2294464


>gb|CP012870.1| Escherichia coli strain K-12 substrain MG1655_TMP32XR2, complete 
genome
Length=4641689

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2328572  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2328513

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2328512  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2328480


>gb|CP012869.1| Escherichia coli strain K-12 substrain MG1655_TMP32XR1, complete 
genome
Length=4641684

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2328572  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2328513

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2328512  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2328480


>gb|CP012868.1| Escherichia coli str. K-12 substr. MG1655, complete genome
Length=4641665

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2328572  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2328513

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2328512  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2328480


>emb|LN877770.1| Escherichia coli genome assembly ERS742059, chromosome : I
Length=5027063

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2676814  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2676873

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2676874  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2676906


>gb|CP011113.1| Escherichia coli strain RR1, complete genome
Length=4587291

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2276721  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2276780

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2276781  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2276813


>gb|CP012127.1| Escherichia coli strain DH1Ec169, complete genome
Length=4609522

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2295354  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2295413

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2295414  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2295446


>gb|CP012126.1| Escherichia coli strain DH1Ec104, complete genome
Length=4612363

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2297968  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2298027

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2298028  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2298060


>gb|CP012125.1| Escherichia coli strain DH1Ec095, complete genome
Length=4614223

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2297967  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2298026

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2298027  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2298059


>gb|CP011495.1| Escherichia coli strain NCM3722, complete genome
Length=4678046

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3552987  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  3553046

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  3553047  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  3553079


>gb|CP009106.2| Escherichia coli strain 94-3024, complete genome
Length=4884464

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3205080  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  3205139

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  3205140  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  3205172


>gb|CP006636.1| Escherichia coli PCN061, complete genome
Length=4603777

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2295869  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2295928

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2295929  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2295961


>gb|CP011324.1| Escherichia coli strain SQ2203, complete genome
Length=4605301

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2304786  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2304845

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2304846  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2304878


>gb|CP011323.1| Escherichia coli strain SQ171, complete genome
Length=4599702

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2304786  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2304845

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2304846  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2304878


>gb|CP011322.1| Escherichia coli strain SQ110, complete genome
Length=4605135

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2304785  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2304844

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2304845  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2304877


>gb|CP011321.1| Escherichia coli strain SQ88, complete genome
Length=4610881

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2304786  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2304845

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2304846  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2304878


>gb|CP011320.1| Escherichia coli strain SQ37, complete genome
Length=4633461

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2310324  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2310383

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2310384  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2310416


>gb|CP010445.1| Escherichia coli K-12 strain ER3435, complete genome
Length=4682086

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3109873  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  3109932

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  3109933  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  3109965


>gb|CP010444.1| Escherichia coli K-12 strain ER3475, complete genome
Length=4609629

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3058611  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  3058670

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  3058671  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  3058703


>gb|CP010443.1| Escherichia coli K-12 strain ER3446, complete genome
Length=4606859

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3055842  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  3055901

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  3055902  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  3055934


>gb|CP010442.1| Escherichia coli K-12 strain ER3466, complete genome
Length=4660432

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3109414  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  3109473

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  3109474  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  3109506


>gb|CP010441.1| Escherichia coli K-12 strain ER3445, complete genome
Length=4607634

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3056616  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  3056675

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  3056676  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  3056708


>gb|CP010440.1| Escherichia coli K-12 strain ER3476, complete genome
Length=4621164

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3070150  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  3070209

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  3070210  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  3070242


>gb|CP010439.1| Escherichia coli K-12 strain ER3440, complete genome
Length=4604543

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3053525  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  3053584

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  3053585  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  3053617


>gb|CP010438.1| Escherichia coli K-12 strain ER3454, complete genome
Length=4619729

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3068711  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  3068770

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  3068771  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  3068803


>emb|LN832404.1| Escherichia coli K-12 genome assembly EcoliK12AG100, chromosome 
: I
Length=4638126

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2315960  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2316019

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2316020  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2316052


>gb|CP011134.1| Escherichia coli VR50, complete genome
Length=5000386

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2468510  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2468569

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2468570  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2468602


>gb|CP010344.1| Escherichia coli ECC-1470, complete genome
Length=4803751

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2427933  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2427992

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2427993  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2428025


>gb|CP009166.1| Escherichia coli 1303, complete genome
Length=4948797

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2527320  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2527379

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2527380  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2527412


>gb|CP010456.1| Synthetic Escherichia coli C321.deltaA substrain rEc.b.dC.12, 
complete sequence
Length=4650152

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2317129  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2317188

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2317189  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2317221


>gb|CP010455.1| Synthetic Escherichia coli C321.deltaA substrain rEc.y.dC.46, 
complete sequence
Length=4650162

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2317127  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2317186

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2317187  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2317219


>gb|CP010371.1| Escherichia coli strain 6409, complete genome
Length=4761012

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2391937  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2391996

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2391997  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2392029


>gb|CP009685.1| Escherichia coli str. K-12 substr. MG1655, complete genome
Length=4636831

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1387068  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  1387009

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  1387008  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  1386976


>gb|CP009789.1| Escherichia coli K-12 strain ER3413, complete genome
Length=4558660

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2303968  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2304027

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2304028  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2304060


>gb|CP009644.1| Escherichia coli ER2796, complete genome
Length=4558663

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2303967  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2304026

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2304027  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2304059


>gb|CP009578.1| Escherichia coli FAP1 genome
Length=4874804

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2878771  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2878830

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2878831  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2878863


>emb|LM995446.1| Escherichia coli genome assembly EcRV308Chr ,chromosome : 1
Length=4585620

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2261141  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2261200

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2261201  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2261233


>emb|LM993812.1| Escherichia coli genome assembly EcHMS174Chr ,chromosome : 1
Length=4584860

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2264689  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2264748

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2264749  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2264781


>gb|CP009273.1| Escherichia coli BW25113, complete genome
Length=4631469

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2306563  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2306622

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2306623  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2306655


>emb|LM997267.1| Escherichia coli genome assembly FHI99, scaffold scaffold-25_contig-7.0_1_270917_[organism:Escherichia
Length=270917

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  172615  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  172556

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               |||||||||||||||||||||||||||||||||
Sbjct  172555  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  172523


>emb|LM997112.1| Escherichia coli genome assembly FHI70, scaffold scaffold-20_contig-20.1_2912_49280_[organism:Escherichia
Length=46369

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1      GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  18202  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  18143

Query  61     TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
              |||||||||||||||||||||||||||||||||
Sbjct  18142  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  18110


>emb|LM996959.1| Escherichia coli genome assembly FHI85, scaffold scaffold-27_contig-5.0_1_330971_[organism:Escherichia
Length=330971

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  186405  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  186464

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               |||||||||||||||||||||||||||||||||
Sbjct  186465  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  186497


>emb|LM996837.1| Escherichia coli genome assembly FHI71, scaffold scaffold-25_contig-2.1_247176_685371_[organism:Escherichia
Length=438196

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  419402  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  419461

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               |||||||||||||||||||||||||||||||||
Sbjct  419462  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  419494


>emb|LM996756.1| Escherichia coli genome assembly FHI8, scaffold scaffold-33_contig-0.0_1_783257_[organism:Escherichia
Length=783257

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  540901  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  540842

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               |||||||||||||||||||||||||||||||||
Sbjct  540841  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  540809


>emb|LM996697.1| Escherichia coli genome assembly FHI79, scaffold scaffold-25_contig-4.0_1_285458_[organism:Escherichia
Length=285458

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1      GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  27355  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  27296

Query  61     TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
              |||||||||||||||||||||||||||||||||
Sbjct  27295  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  27263


>emb|LM996528.1| Escherichia coli genome assembly FHI65, scaffold scaffold-21_contig-5.0_1_313532_[organism:Escherichia
Length=313532

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  257673  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  257732

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               |||||||||||||||||||||||||||||||||
Sbjct  257733  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  257765


>emb|LM996494.1| Escherichia coli genome assembly FHI34, scaffold scaffold-23_contig-2.1_247893_715567_[organism:Escherichia
Length=467675

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  179888  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  179829

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               |||||||||||||||||||||||||||||||||
Sbjct  179828  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  179796


>emb|LM996366.1| Escherichia coli genome assembly FHI6, scaffold scaffold-31_contig-2.0_1_436043_[organism:Escherichia
Length=436043

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  281001  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  281060

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               |||||||||||||||||||||||||||||||||
Sbjct  281061  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  281093


>emb|LM995935.1| Escherichia coli genome assembly FHI4, scaffold scaffold-23_contig-10.1_3328_143504_[organism:Escherichia
Length=140177

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1      GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  17612  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  17553

Query  61     TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
              |||||||||||||||||||||||||||||||||
Sbjct  17552  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  17520


>emb|LM995905.1| Escherichia coli genome assembly FHI30, scaffold scaffold-27_contig-0.0_1_1238179_[organism:Escherichia
Length=1238179

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  372305  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  372246

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               |||||||||||||||||||||||||||||||||
Sbjct  372245  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  372213


>emb|LM995867.1| Escherichia coli genome assembly FHI29, scaffold scaffold-22_contig-0.2_960187_1697133_[organism:Escherichia
Length=736947

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  246296  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  246355

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               |||||||||||||||||||||||||||||||||
Sbjct  246356  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  246388


>emb|LM995830.1| Escherichia coli genome assembly FHI20, scaffold scaffold-22_contig-5.0_1_383698_[organism:Escherichia
Length=383698

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1      GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  17666  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  17607

Query  61     TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
              |||||||||||||||||||||||||||||||||
Sbjct  17606  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  17574


>emb|LM995788.1| Escherichia coli genome assembly FHI28, scaffold scaffold-21_contig-0.1_87396_1078369_[organism:Escherichia
Length=990974

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  610828  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  610887

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               |||||||||||||||||||||||||||||||||
Sbjct  610888  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  610920


>emb|LM995758.1| Escherichia coli genome assembly FHI24, scaffold scaffold-38_contig-2.0_1_502403_[organism:Escherichia
Length=502403

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  454007  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  454066

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               |||||||||||||||||||||||||||||||||
Sbjct  454067  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  454099


>emb|LM995705.1| Escherichia coli genome assembly FHI27, scaffold scaffold-27_contig-0.0_1_488507_[organism:Escherichia
Length=488507

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  470693  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  470752

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               |||||||||||||||||||||||||||||||||
Sbjct  470753  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  470785


>emb|LK999983.1| Escherichia coli genome assembly FHI59, scaffold scaffold-21A
Length=1893946

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1113484  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  1113543

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  1113544  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  1113576


>emb|LK999959.1| Escherichia coli genome assembly FHI42, scaffold scaffold-33
Length=684185

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  443696  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  443637

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               |||||||||||||||||||||||||||||||||
Sbjct  443636  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  443604


>emb|LK985432.1| Escherichia coli genome assembly FHI100, scaffold scaffold-31
Length=498865

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  482785  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  482844

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               |||||||||||||||||||||||||||||||||
Sbjct  482845  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  482877


>emb|LM997321.1| Escherichia coli genome assembly FHI90, scaffold scaffold-26_contig-5.0_1_394194_[organism:Escherichia
Length=394194

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1      GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  17560  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  17501

Query  61     TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
              |||||||||||||||||||||||||||||||||
Sbjct  17500  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  17468


>emb|LK931336.1| Citrobacter koseri genome assembly PRJEB6512_assembly_1 ,scaffold 
CONTIG000001
Length=4763704

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  582130  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  582071

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               |||||||||||||||||||||||||||||||||
Sbjct  582070  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  582038


>gb|CP005998.1| Escherichia coli B7A, complete genome
Length=4944397

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4781389  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  4781330

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  4781329  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  4781297


>gb|CP008801.1| Escherichia coli KLY, complete genome
Length=4718545

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2288787  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2288846

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2288847  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2288879


>emb|HG738867.1| Escherichia coli str. K-12 substr. MC4100 complete genome
Length=4527247

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2195357  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2195416

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2195417  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2195449


>gb|CP006698.1| Synthetic Escherichia coli C321.deltaA, complete sequence
Length=4643553

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2317113  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2317172

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2317173  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2317205


>gb|U00096.3| Escherichia coli str. K-12 substr. MG1655, complete genome
Length=4641652

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2313084  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2313143

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2313144  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2313176


>gb|CP006584.1| Escherichia coli LY180, complete genome
Length=4835601

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2420198  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2420257

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2420258  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2420290


>gb|CP002967.1| Escherichia coli W, complete genome
Length=4897452

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2477111  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2477170

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2477171  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2477203


>gb|CP002970.1| Escherichia coli KO11FL, complete genome
Length=5021812

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2475645  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2475586

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2475585  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2475553


>gb|CP002291.1| Escherichia coli P12b, complete genome
Length=4935294

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2500751  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2500810

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2500811  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2500843


>dbj|AP012306.1| Escherichia coli str. K-12 substr. MDS42 DNA, complete genome
Length=3976195

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1883451  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  1883510

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  1883511  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  1883543


>gb|CP002729.1| Escherichia coli UMNK88, complete genome
Length=5186416

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2665438  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2665497

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2665498  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2665530


>gb|CP002516.1| Escherichia coli KO11, complete genome
Length=4920168

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1625323  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  1625264

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  1625263  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  1625231


>dbj|AP012030.1| Escherichia coli DH1 (ME8569) DNA, complete genome
Length=4621430

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2297965  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2298024

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2298025  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2298057


>gb|CP002185.1| Escherichia coli W, complete genome
Length=4900968

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2480534  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2480593

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2480594  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2480626


>emb|FN649414.1| Escherichia coli ETEC H10407, complete genome
 gb|CP007594.1| Escherichia coli strain SEC470, complete genome
Length=5153435

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2538681  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2538740

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2538741  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2538773


>gb|CP001637.1| Escherichia coli DH1, complete genome
Length=4630707

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1563888  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  1563829

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  1563828  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  1563796


>dbj|AP010960.1| Escherichia coli O111:H- str. 11128 DNA, complete genome
Length=5371077

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2889466  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2889525

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2889526  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2889558


>dbj|AP010953.1| Escherichia coli O26:H11 str. 11368 DNA, complete genome
Length=5697240

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3075148  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  3075207

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  3075208  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  3075240


>gb|CP001396.1| Escherichia coli BW2952, complete genome
Length=4578159

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2196911  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2196970

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2196971  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2197003


>emb|CU928160.2| Escherichia coli IAI1 chromosome, complete genome
Length=4700560

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2371467  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2371526

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2371527  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2371559


>dbj|AP009240.1| Escherichia coli SE11 DNA, complete genome
Length=4887515

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2566019  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2566078

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2566079  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2566111


>gb|CP000948.1| Escherichia coli str. K12 substr. DH10B, complete genome
Length=4686137

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2402094  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2402153

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2402154  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2402186


>gb|CP000822.1| Citrobacter koseri ATCC BAA-895, complete genome
Length=4720462

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  542635  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  542576

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               |||||||||||||||||||||||||||||||||
Sbjct  542575  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  542543


>gb|CP000800.1| Escherichia coli E24377A, complete genome
Length=4979619

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2499421  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2499480

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2499481  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2499513


>dbj|AP009048.1| Escherichia coli str. K12 substr. W3110 DNA, complete genome
Length=4646332

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2316418  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2316477

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  2316478  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  2316510


>gb|K00541.1|ECOOMPC E.coli ompC and micF genes coding for major outer membrane protein 
OmpC and mRNA-interfering complementary RNA (micRNA)
Length=1713

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1    GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  156  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  97

Query  61   TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
            |||||||||||||||||||||||||||||||||
Sbjct  96   TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  64


>emb|X04888.1| E.coli micF gene for regulatory antisense RNA
Length=129

 Score =  172 bits (93),  Expect = 7e-40
 Identities = 93/93 (100%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1    GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  37   GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  96

Query  61   TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
            |||||||||||||||||||||||||||||||||
Sbjct  97   TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  129


>gb|CP012140.1| Shigella flexneri 4c strain 1205, complete genome
Length=4683636

 Score =  171 bits (92),  Expect = 2e-39
 Identities = 92/92 (100%), Gaps = 0/92 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  905892  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  905833

Query  61      TTTCAACCGGATGCCTCGCATTCGGttttttt  92
               ||||||||||||||||||||||||||||||||
Sbjct  905832  TTTCAACCGGATGCCTCGCATTCGGTTTTTTT  905801


>gb|CP012137.1| Shigella flexneri 2a strain 981, complete genome
Length=4661157

 Score =  171 bits (92),  Expect = 2e-39
 Identities = 92/92 (100%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2377973  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2378032

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||||||||||||||
Sbjct  2378033  TTTCAACCGGATGCCTCGCATTCGGTTTTTTT  2378064


>gb|CP012735.1| Shigella flexneri 1a strain 0228, complete genome
Length=4698633

 Score =  171 bits (92),  Expect = 2e-39
 Identities = 92/92 (100%), Gaps = 0/92 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2604608  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2604549

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||||||||||||||
Sbjct  2604548  TTTCAACCGGATGCCTCGCATTCGGTTTTTTT  2604517


>gb|CP007037.1| Shigella flexneri G1663, complete genome
Length=4594725

 Score =  171 bits (92),  Expect = 2e-39
 Identities = 92/92 (100%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2316444  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2316503

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||||||||||||||
Sbjct  2316504  TTTCAACCGGATGCCTCGCATTCGGTTTTTTT  2316535


>emb|LM651928.1| Shigella flexneri genome assembly NCTC1 ,chromosome : 1
Length=4526576

 Score =  171 bits (92),  Expect = 2e-39
 Identities = 92/92 (100%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2297604  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2297663

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||||||||||||||
Sbjct  2297664  TTTCAACCGGATGCCTCGCATTCGGTTTTTTT  2297695


>gb|CP004057.1| Shigella flexneri Shi06HN006, complete genome
Length=4620903

 Score =  171 bits (92),  Expect = 2e-39
 Identities = 92/92 (100%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2361690  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2361749

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||||||||||||||
Sbjct  2361750  TTTCAACCGGATGCCTCGCATTCGGTTTTTTT  2361781


>gb|CP004056.1| Shigella flexneri 2003036, complete genome
Length=4595814

 Score =  171 bits (92),  Expect = 2e-39
 Identities = 92/92 (100%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2337719  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2337778

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||||||||||||||
Sbjct  2337779  TTTCAACCGGATGCCTCGCATTCGGTTTTTTT  2337810


>gb|AE005674.2| Shigella flexneri 2a str. 301, complete genome
Length=4607202

 Score =  171 bits (92),  Expect = 2e-39
 Identities = 92/92 (100%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2334487  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2334546

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||||||||||||||
Sbjct  2334547  TTTCAACCGGATGCCTCGCATTCGGTTTTTTT  2334578


>gb|CP001383.1| Shigella flexneri 2002017, complete genome
Length=4650856

 Score =  171 bits (92),  Expect = 2e-39
 Identities = 92/92 (100%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2373445  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2373504

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||||||||||||||
Sbjct  2373505  TTTCAACCGGATGCCTCGCATTCGGTTTTTTT  2373536


>gb|CP000266.1| Shigella flexneri 5 str. 8401, complete genome
Length=4574284

 Score =  171 bits (92),  Expect = 2e-39
 Identities = 92/92 (100%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2328213  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2328272

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||||||||||||||
Sbjct  2328273  TTTCAACCGGATGCCTCGCATTCGGTTTTTTT  2328304


>gb|AE014073.1| Shigella flexneri 2a str. 2457T, complete genome
Length=4599354

 Score =  171 bits (92),  Expect = 2e-39
 Identities = 92/92 (100%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2313945  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2314004

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||||||||||||||
Sbjct  2314005  TTTCAACCGGATGCCTCGCATTCGGTTTTTTT  2314036


>gb|CP000036.1| Shigella boydii Sb227, complete genome
Length=4519823

 Score =  171 bits (92),  Expect = 2e-39
 Identities = 92/92 (100%), Gaps = 0/92 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2072518  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2072459

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||||||||||||||
Sbjct  2072458  TTTCAACCGGATGCCTCGCATTCGGTTTTTTT  2072427


>gb|CP015832.1| Escherichia coli O157 strain 180-PT54, complete genome
Length=5509528

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1762864  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  1762805

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  1762804  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  1762772


>gb|CP015831.1| Escherichia coli O157 strain 644-PT8, complete genome
Length=5831209

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1762051  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  1761992

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  1761991  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  1761959


>gb|CP015241.1| Escherichia coli strain 2013C-4465, complete genome
Length=5428937

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  334645  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  334704

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  334705  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  334737


>gb|CP015240.1| Escherichia coli strain 2011C-3911, complete genome
Length=4863599

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  324155  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  324214

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  324215  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  324247


>gb|CP011292.1| Salmonella enterica subsp. diarizonae strain 11-01854, complete 
genome
Length=4779347

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3404485  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  3404544

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  3404545  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  3404577


>gb|CP011289.1| Salmonella enterica subsp. diarizonae strain 11-01853, complete 
genome
Length=4779348

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3404486  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  3404545

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  3404546  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  3404578


>gb|CP011288.1| Salmonella enterica subsp. diarizonae strain 11-01855, complete 
genome
Length=4779347

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3404485  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  3404544

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  3404545  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  3404577


>gb|CP015076.1| Escherichia coli strain Ecol_448, complete genome
Length=5007393

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1923122  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  1923181

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  1923182  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  1923214


>gb|CP015074.1| Escherichia coli strain Ecol_745, complete genome
Length=4977360

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2359876  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2359817

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2359816  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2359784


>gb|CP015069.1| Escherichia coli strain Ecol_743, complete genome
Length=4856574

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1064705  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  1064764

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  1064765  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  1064797


>gb|CP015138.1| Escherichia coli strain Ecol_732, complete genome
Length=5009900

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3581631  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  3581572

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  3581571  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  3581539


>gb|CP015023.1| Escherichia coli strain SRCC 1675, complete genome
Length=5506801

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1098066  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  1098125

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  1098126  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  1098158


>gb|CP015020.1| Escherichia coli strain 28RC1, complete genome
Length=5561698

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1352915  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  1352974

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  1352975  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  1353007


>gb|CP011061.1| Escherichia coli str. Sanji, complete genome
Length=4891769

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2392497  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2392556

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2392557  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2392589


>gb|CP014316.1| Escherichia coli JJ1887, complete genome
Length=5081061

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2508370  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2508429

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2508430  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2508462


>gb|CP014522.1| Escherichia coli strain ZH063, complete genome
Length=5033359

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2483819  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2483878

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2483879  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2483911


>gb|CP014497.1| Escherichia coli strain ZH193, complete genome
Length=5046610

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2516485  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2516544

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2516545  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2516577


>gb|CP014495.1| Escherichia coli strain SaT040, complete geome
Length=5061821

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2512810  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2512869

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2512870  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2512902


>gb|CP014492.1| Escherichia coli strain MVAST0167, complete genome
Length=4806946

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2295956  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2296015

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2296016  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2296048


>gb|CP014488.1| Escherichia coli strain G749, complete genome
Length=4897758

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2308985  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2309044

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2309045  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2309077


>gb|CP014314.1| Escherichia coli O157:H7 strain JEONG-1266, complete genome
Length=5478683

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  927872  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  927813

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  927812  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  927780


>gb|CP014099.1| Shigella sonnei strain FDAARGOS_90, complete genome
Length=4878853

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  459248  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  459189

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  459188  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  459156


>gb|CP013962.1| Escherichia coli strain SEC470 genome
Length=5610558

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3412626  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  3412567

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  3412566  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  3412534


>gb|CP010829.1| Shigella sonnei strain FORC_011, complete genome
Length=4824850

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2390207  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2390266

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2390267  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2390299


>gb|CP007491.1| Escherichia coli strain ACN002, complete genome
Length=4879931

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2393489  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2393548

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2393549  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2393581


>gb|CP013837.1| Escherichia coli strain JJ1897, complete genome
Length=5174541

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2642198  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2642257

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2642258  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2642290


>gb|CP013835.1| Escherichia coli strain JJ2434, complete genome
Length=5128614

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2543878  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2543937

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2543938  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2543970


>gb|CP013831.1| Escherichia coli strain CD306, complete genome
Length=5073822

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2543588  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2543647

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2543648  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2543680


>gb|CP013658.1| Escherichia coli strain uk_P46212, complete sequence
Length=5106662

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1554890  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  1554949

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  1554950  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  1554982


>gb|CP013338.1| Raoultella ornithinolytica strain Yangling I2, complete genome
Length=5492557

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1616230  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  1616171

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||||||||||||||||
Sbjct  1616170  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  1616138


>gb|CP013112.1| Escherichia coli strain YD786, complete genome
Length=4863501

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1920567  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  1920626

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  1920627  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  1920659


>gb|CP013025.1| Escherichia coli strain 2009C-3133, complete genome
Length=5155368

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3973658  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  3973599

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  3973598  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  3973566


>gb|CP012802.1| Escherichia coli O157:H7 strain WS4202, complete genome
Length=5332063

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2918562  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2918621

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2918622  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2918654


>gb|CP012633.1| Escherichia coli strain SF-166, complete genome
Length=4910962

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1682521  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  1682462

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  1682461  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  1682429


>gb|CP012631.1| Escherichia coli strain SF-173, complete genome
Length=5059732

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1657945  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  1657886

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  1657885  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  1657853


>gb|CP012635.1| Escherichia coli strain SF-088, complete genome
Length=5048243

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1644734  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  1644675

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  1644674  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  1644642


>gb|CP012625.1| Escherichia coli strain SF-468, complete genome
Length=5142799

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1800690  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  1800631

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  1800630  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  1800598


>gb|CP012038.1| Salmonella enterica subsp. enterica serovar Ouakam strain GNT-01 
genome
Length=5088451

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1039523  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  1039582

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1039583  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1039615


>gb|CP007442.1| Escherichia coli ACN001, complete genome
Length=4936576

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2355296  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2355355

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2355356  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2355388


>gb|CP006632.1| Escherichia coli PCN033, complete genome
Length=4987957

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2426227  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2426286

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2426287  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2426319


>gb|CP011511.1| Shigella boydii strain ATCC 9210, complete genome
Length=4574246

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2267347  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2267406

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2267407  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2267439


>gb|CP011416.1| Escherichia coli strain CFSAN029787, complete genome
Length=4947515

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  504563  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  504622

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  504623  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  504655


>gb|CP011331.1| Escherichia coli O104:H4 str. C227-11, complete genome
Length=5292862

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1052736  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  1052677

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  1052676  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  1052644


>gb|CP011018.1| Escherichia coli strain CI5, complete genome
Length=4885378

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  128552  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  128493

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  128492  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  128460


>emb|LN831045.1| Escherichia coli genome assembly NCTC9001, plasmid : 6
Length=1154146

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  994040  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  994099

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  994100  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  994132


>gb|CP007149.1| Escherichia coli RS218, complete genome
Length=5087638

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2468510  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2468569

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2468570  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2468602


>gb|CP010876.1| Escherichia coli strain MNCRE44, complete genome
Length=5010884

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2469350  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2469409

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2469410  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2469442


>gb|CP007592.1| Escherichia coli O157:H16 strain Santai, complete genome
Length=5104557

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2697433  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2697492

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2697493  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2697525


>gb|CP010315.1| Escherichia coli strain 789, complete genome
Length=5017219

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2615628  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2615687

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2615688  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2615720


>emb|HF572917.2| Escherichia coli HUSEC2011 complete genome
Length=5277676

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2705868  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2705927

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2705928  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2705960


>gb|CP010304.1| Escherichia coli O157:H7 str. SS52, complete genome
Length=5488700

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3002702  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  3002761

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  3002762  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  3002794


>gb|CP009104.1| Escherichia coli strain RM9387, complete genome
Length=4827630

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3257638  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  3257697

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  3257698  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  3257730


>gb|CP009859.1| Escherichia coli strain ECONIH1, complete genome
Length=5310511

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2600035  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2600094

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2600095  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2600127


>emb|LN554916.1| Escherichia coli genome assembly FHI62, scaffold scaffold-18_contig-5.0_1_486310_[organism:Escherichia
Length=486310

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  151785  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  151726

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  151725  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  151693


>emb|LM997224.1| Escherichia coli genome assembly FHI97, scaffold scaffold-37_contig-10.0_1_234584_[organism:Escherichia
Length=234584

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  120334  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  120393

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  120394  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  120426


>emb|LM997161.1| Escherichia coli genome assembly FHI92, scaffold scaffold-14_contig-10.0_1_173985_[organism:Escherichia
Length=173985

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1      GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  44289  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  44230

Query  61     TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
              ||||||||||||||||||||| |||||||||||
Sbjct  44229  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  44197


>emb|LM997077.1| Escherichia coli genome assembly FHI9, scaffold scaffold-28_contig-6.1_73478_305391_[organism:Escherichia
Length=231914

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  127561  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  127502

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  127501  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  127469


>emb|LM997039.1| Escherichia coli genome assembly FHI89, scaffold scaffold-20_contig-1.0_1_1073266_[organism:Escherichia
Length=1073266

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  380657  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  380598

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  380597  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  380565


>emb|LM997002.1| Escherichia coli genome assembly FHI87, scaffold scaffold-21_contig-3.0_1_501243_[organism:Escherichia
Length=501243

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  388543  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  388484

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  388483  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  388451


>emb|LM996927.1| Escherichia coli genome assembly FHI83, scaffold scaffold-27_contig-0.0_1_839850_[organism:Escherichia
Length=839850

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  427280  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  427221

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  427220  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  427188


>emb|LM996867.1| Escherichia coli genome assembly FHI72, scaffold scaffold-25_contig-8.0_1_178263_[organism:Escherichia
Length=178263

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  153610  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  153551

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  153550  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  153518


>emb|LM996787.1| Escherichia coli genome assembly FHI82, scaffold scaffold-22_contig-7.1_14705_274494_[organism:Escherichia
Length=259790

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  122678  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  122619

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  122618  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  122586


>emb|LM996651.1| Escherichia coli genome assembly FHI75, scaffold scaffold-25_contig-1.0_1_691636_[organism:Escherichia
Length=691636

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  302932  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  302991

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  302992  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  303024


>emb|LM996610.1| Escherichia coli genome assembly FHI74, scaffold scaffold-18_contig-5.0_1_493321_[organism:Escherichia
Length=493321

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  107204  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  107263

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  107264  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  107296


>emb|LM996572.1| Escherichia coli genome assembly FHI21, scaffold scaffold-26_contig-4.0_1_420823_[organism:Escherichia
Length=420823

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  149063  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  149004

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  149003  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  148971


>emb|LM996455.1| Escherichia coli genome assembly FHI63, scaffold scaffold-37_contig-6.0_1_345766_[organism:Escherichia
Length=345766

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  164824  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  164765

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  164764  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  164732


>emb|LM996319.1| Escherichia coli genome assembly FHI25, scaffold scaffold-27_contig-0.0_1_343315_[organism:Escherichia
Length=343315

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  164717  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  164658

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  164657  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  164625


>emb|LM996255.1| Escherichia coli genome assembly FHI40, scaffold scaffold-26_contig-56.10_258144_299863_[organism:Escherichia
Length=41720

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1      GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  30880  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  30939

Query  61     TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
              ||||||||||||||||||||| |||||||||||
Sbjct  30940  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  30972


>emb|LM996121.1| Escherichia coli genome assembly FHI14, scaffold scaffold-28_contig-0.0_1_488566_[organism:Escherichia
Length=488566

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  103469  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  103528

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  103529  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  103561


>emb|LM996078.1| Escherichia coli genome assembly FHI43, scaffold scaffold-14_contig-3.5_58947_514354_[organism:Escherichia
Length=455408

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  155293  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  155234

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  155233  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  155201


>emb|LM996036.1| Escherichia coli genome assembly FHI48, scaffold scaffold-28_contig-6.1_2595_452528_[organism:Escherichia
Length=449934

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  152639  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  152580

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  152579  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  152547


>emb|LM995998.1| Escherichia coli genome assembly FHI58, scaffold scaffold-28_contig-0.0_1_529583_[organism:Escherichia
Length=529583

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  348523  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  348464

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  348463  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  348431


>emb|LM995659.1| Escherichia coli genome assembly FHI23, scaffold scaffold-32_contig-0.0_1_1236124_[organism:Escherichia
Length=1236124

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  874246  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  874305

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  874306  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  874338


>emb|LM995598.1| Escherichia coli genome assembly FHI15, scaffold scaffold-33_contig-8.0_1_284625_[organism:Escherichia
Length=284625

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  183746  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  183687

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  183686  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  183654


>emb|LM995544.1| Escherichia coli genome assembly FHI12, scaffold scaffold-23_contig-4.0_1_312896_[organism:Escherichia
Length=312896

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  184221  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  184162

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  184161  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  184129


>emb|LM995511.1| Escherichia coli genome assembly FHI102, scaffold scaffold-27_contig-2.0_1_645874_[organism:Escherichia
Length=645874

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  411236  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  411177

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  411176  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  411144


>emb|LM995468.1| Escherichia coli genome assembly FHI11, scaffold scaffold-16_contig-9.0_1_286800_[organism:Escherichia
Length=286800

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  183834  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  183775

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  183774  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  183742


>emb|LK931552.1| Escherichia coli genome assembly StOlav104, scaffold scaffold-50
Length=399493

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  233703  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  233762

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  233763  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  233795


>emb|LM997396.1| Escherichia coli genome assembly FHI7, scaffold scaffold-21_contig-6.0_1_323401_[organism:Escherichia
Length=323401

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  183746  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  183687

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  183686  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  183654


>emb|LM997368.1| Escherichia coli genome assembly FHI98, scaffold scaffold-30_contig-1.0_1_505787_[organism:Escherichia
Length=505787

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  380772  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  380713

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  380712  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  380680


>gb|CP009072.1| Escherichia coli ATCC 25922, complete genome
Length=5130767

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  141331  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  141390

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  141391  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  141423


>gb|CP008957.1| Escherichia coli O157:H7 str. EDL933, complete genome
Length=5547323

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3134390  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  3134449

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  3134450  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  3134482


>gb|CP008805.1| Escherichia coli O157:H7 str. SS17, complete genome
Length=5523849

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3039853  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  3039912

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  3039913  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  3039945


>emb|LK931502.1| Salmonella enterica subsp. enterica serovar Dublin genome assembly 
SC50_1 ,chromosome : I
Length=4814038

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2193591  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2193650

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2193651  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2193683


>gb|CP007799.1| Escherichia coli Nissle 1917, complete genome
Length=5441200

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2572106  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2572165

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2572166  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2572198


>emb|HG941718.1| Escherichia coli ST131 strain EC958 chromosome, complete genome
Length=5109767

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2510213  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2510272

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2510273  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2510305


>gb|CP007136.1| Escherichia coli O145:H28 str. RM12581, complete genome
Length=5585611

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2877281  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2877340

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2877341  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2877373


>gb|CP007133.1| Escherichia coli O145:H28 str. RM12761, complete genome
Length=5402281

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2862553  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2862612

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2862613  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2862645


>gb|CP007391.1| Escherichia coli strain ST540, complete genome
Length=4875682

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1687228  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  1687169

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  1687168  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  1687136


>gb|CP007390.1| Escherichia coli strain ST540, complete genome
Length=4807977

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1592453  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  1592394

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  1592393  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  1592361


>gb|CP007265.1| Escherichia coli strain ST540, complete genome
Length=4758629

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3080838  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  3080897

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  3080898  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  3080930


>gb|CP006027.1| Escherichia coli O145:H28 str. RM13514, complete genome
Length=5585613

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2877283  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2877342

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2877343  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2877375


>gb|CP006262.1| Escherichia coli O145:H28 str. RM13516, complete genome
Length=5402276

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2862549  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2862608

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2862609  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2862641


>emb|HF969015.2| Salmonella enterica subsp. enterica serovar Bovismorbificans 
str. 3114 complete genome
Length=4680283

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2311914  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2311973

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2311974  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2312006


>gb|CP006784.1| Escherichia coli JJ1886, complete genome
Length=5129938

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2510312  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2510371

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2510372  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2510404


>emb|HG428755.1| Escherichia coli PMV-1 main chromosome, complete genome
Length=4984940

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2452310  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2452369

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2452370  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2452402


>gb|CP004142.1| Raoultella ornithinolytica B6, complete genome
Length=5398151

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  301513  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  301454

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               |||||||||||||||||||||||||||||||||
Sbjct  301453  TTTCAACCGGATGCCTCGCATTCGGTTTTTTTT  301421


>gb|CP004009.1| Escherichia coli APEC O78, complete genome
Length=4798435

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3078960  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  3079019

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  3079020  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  3079052


>gb|CP003301.1| Escherichia coli O104:H4 str. 2009EL-2071, complete genome
Length=5312586

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1739595  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  1739536

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  1739535  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  1739503


>gb|CP003289.1| Escherichia coli O104:H4 str. 2011C-3493, complete genome
Length=5273097

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1744641  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  1744582

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  1744581  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  1744549


>gb|CP003297.1| Escherichia coli O104:H4 str. 2009EL-2050, complete genome
Length=5253138

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1731905  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  1731846

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  1731845  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  1731813


>gb|CP001925.1| Escherichia coli Xuzhou21, complete genome
Length=5386223

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2974156  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2974215

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2974216  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2974248


>gb|CP003109.1| Escherichia coli O55:H7 str. RM12579, complete genome
Length=5263980

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2796978  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2797037

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2797038  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2797070


>emb|HE616528.1| Shigella sonnei 53G main chromosome, complete genome
Length=4988504

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2478937  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2478996

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2478997  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2479029


>gb|CP002212.1| Escherichia coli str. 'clone D i14', complete genome
Length=5038386

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2537381  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2537440

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2537441  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2537473


>gb|CP002211.1| Escherichia coli str. 'clone D i2', complete genome
Length=5038386

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2537381  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2537440

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2537441  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2537473


>gb|CP003034.1| Escherichia coli O7:K1 str. CE10, complete genome
Length=5313531

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2616514  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2616573

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2616574  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2616606


>gb|CP001855.1| Escherichia coli O83:H1 str. NRG 857C, complete genome
Length=4747819

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2335285  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2335344

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2335345  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2335377


>gb|CP001671.1| Escherichia coli ABU 83972, complete genome
Length=5131397

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2570812  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2570871

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2570872  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2570904


>gb|CP001969.1| Escherichia coli IHE3034, complete genome
Length=5108383

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2527558  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2527617

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2527618  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2527650


>gb|CP001846.1| Escherichia coli O55:H7 str. CB9615, complete genome
Length=5386352

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2786826  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2786885

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2786886  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2786918


>emb|FN554766.1| Escherichia coli 042 complete genome
Length=5241977

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2584955  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2585014

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2585015  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2585047


>dbj|AP009378.1| Escherichia coli SE15 DNA, complete genome
Length=4717338

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2260115  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2260174

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2260175  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2260207


>dbj|AP010958.1| Escherichia coli O103:H2 str. 12009 DNA, complete genome
Length=5449314

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2722923  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2722982

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2722983  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2723015


>gb|CP001368.1| Escherichia coli O157:H7 str. TW14359, complete genome
Length=5528136

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3042304  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  3042363

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  3042364  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  3042396


>emb|CU651637.1| Escherichia coli LF82 chromosome, complete sequence
Length=4773108

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2327446  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2327505

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2327506  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2327538


>emb|CU928163.2| Escherichia coli UMN026 chromosome, complete genome
Length=5202090

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2613556  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2613615

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2613616  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2613648


>emb|CU928162.2| Escherichia coli ED1a chromosome, complete genome
Length=5209548

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2603583  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2603642

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2603643  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2603675


>emb|CU928164.2| Escherichia coli IAI39 chromosome, complete genome
Length=5132068

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2425289  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2425348

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2425349  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2425381


>emb|CU928161.2| Escherichia coli S88 chromosome, complete genome
Length=5032268

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2345210  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2345269

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2345270  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2345302


>emb|CU928145.2| Escherichia coli 55989 chromosome, complete genome
Length=5154862

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2526544  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2526603

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2526604  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2526636


>emb|FM180568.1| Escherichia coli 0127:H6 E2348/69 complete genome, strain E2348/69
Length=4965553

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2440301  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2440360

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2440361  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2440393


>gb|CP001164.1| Escherichia coli O157:H7 str. EC4115, complete genome
Length=5572075

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3087433  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  3087492

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  3087493  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  3087525


>gb|CP001144.1| Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853, 
complete genome
Length=4842908

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2488066  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2488125

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2488126  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2488158


>gb|CP001063.1| Shigella boydii CDC 3083-94, complete genome
Length=4615997

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  683610  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  683551

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  683550  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  683518


>gb|CP000970.1| Escherichia coli SMS-3-5, complete genome
Length=5068389

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2396795  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2396854

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2396855  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2396887


>gb|CP000946.1| Escherichia coli ATCC 8739, complete genome
Length=4746218

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1583436  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  1583377

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  1583376  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  1583344


>gb|CP000802.1| Escherichia coli HS, complete genome
Length=4643538

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2354068  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2354127

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2354128  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2354160


>gb|CP000468.1| Escherichia coli APEC O1, complete genome
Length=5082025

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2422077  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2422136

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2422137  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2422169


>gb|CP000247.1| Escherichia coli 536, complete genome
Length=4938920

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2350132  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2350191

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2350192  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2350224


>gb|CP000243.1| Escherichia coli UTI89, complete genome
Length=5065741

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2449387  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2449446

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2449447  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2449479


>gb|AE014075.1| Escherichia coli CFT073, complete genome
Length=5231428

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2600051  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2600110

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2600111  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2600143


>dbj|BA000007.2| Escherichia coli O157:H7 str. Sakai DNA, complete genome
Length=5498450

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3046071  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  3046130

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  3046131  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  3046163


>gb|CP000038.1| Shigella sonnei Ss046, complete genome
Length=4825265

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2388058  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2388117

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2388118  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2388150


>gb|AE005174.2| Escherichia coli O157:H7 EDL933, complete genome
Length=5528445

 Score =  167 bits (90),  Expect = 3e-38
 Identities = 92/93 (98%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3117340  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  3117399

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  3117400  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  3117432


>gb|CP014197.1| Escherichia coli strain MRE600, complete genome
Length=4827745

 Score =  165 bits (89),  Expect = 1e-37
 Identities = 91/92 (98%), Gaps = 0/92 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1449240  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  1449181

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||| ||||||||||
Sbjct  1449180  TTTCAACCGGATGCCTCGCATCCGGTTTTTTT  1449149


>gb|CP008697.1| Escherichia coli strain ST648, complete genome
Length=5056598

 Score =  165 bits (89),  Expect = 1e-37
 Identities = 91/92 (98%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3208241  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  3208300

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||| ||||||||||
Sbjct  3208301  TTTCAACCGGATGCCTCGCATCCGGTTTTTTT  3208332


>gb|CP005930.1| Escherichia coli APEC IMT5155, complete genome
Length=4929051

 Score =  165 bits (89),  Expect = 1e-37
 Identities = 91/92 (98%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  343002  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  343061

Query  61      TTTCAACCGGATGCCTCGCATTCGGttttttt  92
               ||||||||||||||||||||| ||||||||||
Sbjct  343062  TTTCAACCGGATGCCTCGCATCCGGTTTTTTT  343093


>emb|LM996403.1| Escherichia coli genome assembly FHI66, scaffold scaffold-27_contig-5.0_1_352649_[organism:Escherichia
Length=352649

 Score =  165 bits (89),  Expect = 1e-37
 Identities = 91/92 (98%), Gaps = 0/92 (0%)
 Strand=Plus/Minus

Query  1      GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  38077  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  38018

Query  61     TTTCAACCGGATGCCTCGCATTCGGttttttt  92
              ||||||||||||||||||||| ||||||||||
Sbjct  38017  TTTCAACCGGATGCCTCGCATCCGGTTTTTTT  37986


>gb|CP007394.1| Escherichia coli strain ST2747, complete genome
Length=5090442

 Score =  165 bits (89),  Expect = 1e-37
 Identities = 91/92 (98%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3103313  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  3103372

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||| ||||||||||
Sbjct  3103373  TTTCAACCGGATGCCTCGCATCCGGTTTTTTT  3103404


>gb|CP007393.1| Escherichia coli strain ST2747, complete genome
Length=4998910

 Score =  165 bits (89),  Expect = 1e-37
 Identities = 91/92 (98%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3146464  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  3146523

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||| ||||||||||
Sbjct  3146524  TTTCAACCGGATGCCTCGCATCCGGTTTTTTT  3146555


>gb|CP007392.1| Escherichia coli strain ST2747, complete genome
Length=5054509

 Score =  165 bits (89),  Expect = 1e-37
 Identities = 91/92 (98%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3156677  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  3156736

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||| ||||||||||
Sbjct  3156737  TTTCAACCGGATGCCTCGCATCCGGTTTTTTT  3156768


>gb|CP002167.1| Escherichia coli UM146, complete genome
Length=4993013

 Score =  165 bits (89),  Expect = 1e-37
 Identities = 91/92 (98%), Gaps = 0/92 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1193021  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  1192962

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||| ||||||||||
Sbjct  1192961  TTTCAACCGGATGCCTCGCATCCGGTTTTTTT  1192930


>gb|CP014755.1| Klebsiella pneumoniae strain AATZP, complete genome
Length=5353110

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  3694381  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  3694440

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  3694441  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  3694473


>gb|CP011942.1| Salmonella enterica subsp. enterica serovar Enteritidis strain 
OLF-00D989 87-1, complete genome
Length=4679487

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2320388  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2320447

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2320448  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2320480


>gb|CP015753.1| Klebsiella pneumoniae strain W14, complete genome
Length=5220857

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1208033  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  1208092

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  1208093  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  1208125


>gb|CP015500.1| Klebsiella pneumoniae strain SKGH01, complete genome
Length=5490611

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1422128  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  1422069

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  1422068  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  1422036


>gb|CP007584.2| Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1735, 
complete genome
Length=4844415

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1622156  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  1622097

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1622096  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1622064


>gb|CP014979.1| Salmonella enterica subsp. enterica serovar Typhimurium str. 
CDC H2662, complete genome
Length=4891681

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1684183  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  1684124

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1684123  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1684091


>gb|CP014977.1| Salmonella enterica subsp. enterica serovar Typhimurium str. 
USDA-ARS-USMARC-1896, complete genome
Length=4856440

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1688465  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  1688406

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1688405  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1688373


>gb|CP014975.1| Salmonella enterica subsp. enterica serovar Typhimurium str. 
CDC 2009K-1640, complete genome
Length=4933707

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1726101  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  1726042

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1726041  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1726009


>gb|CP014971.1| Salmonella enterica subsp. enterica serovar Typhimurium str. 
USDA-ARS-USMARC-1898, complete genome
Length=4784401

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1686513  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  1686454

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1686453  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1686421


>gb|CP014969.1| Salmonella enterica subsp. enterica serovar Typhimurium str. 
USDA-ARS-USMARC-1808, complete genome
Length=4936894

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1729408  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  1729349

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1729348  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1729316


>gb|CP014967.1| Salmonella enterica subsp. enterica serovar Typhimurium str. 
CDC 2011K-1702, complete genome
Length=4906321

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1728335  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  1728276

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1728275  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1728243


>gb|CP014965.1| Salmonella enterica subsp. enterica serovar Typhimurium str. 
CDC 2010K-1587, complete genome
Length=4799398

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1658065  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  1658006

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1658005  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1657973


>gb|CP014983.1| Salmonella enterica subsp. enterica serovar Typhimurium str. 
CDC 2009K-2059, complete genome
Length=4823793

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1684579  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  1684520

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1684519  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1684487


>gb|CP014982.1| Salmonella enterica subsp. enterica serovar Typhimurium str. 
USDA-ARS-USMARC-1810, complete genome
Length=4927870

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1716414  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  1716355

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1716354  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1716322


>gb|CP014981.1| Salmonella enterica subsp. enterica serovar Typhimurium str. 
USDA-ARS-USMARC-1880, complete genome
Length=4815208

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1716509  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  1716450

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1716449  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1716417


>gb|CP014666.1| Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1781, 
complete genome
Length=4636307

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1591576  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  1591517

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1591516  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1591484


>gb|CP012985.1| Salmonella enterica subsp. enterica serovar Typhimurium strain 
RM9437, complete genome
Length=4958254

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2434298  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2434357

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2434358  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2434390


>gb|CP014994.1| Salmonella enterica subsp. enterica serovar Tennessee strain 
CFSAN001387, complete genome
Length=4834050

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1679613  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  1679554

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1679553  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1679521


>gb|CP015024.1| Salmonella enterica subsp. enterica serovar Agona str. 392869-2, 
complete genome
Length=4798530

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1645986  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  1645927

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1645926  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1645894


>gb|CP012744.1| Klebsiella pneumoniae subsp. pneumoniae strain TGH10, complete 
genome
Length=5355459

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1626903  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  1626844

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  1626843  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  1626811


>gb|CP012743.1| Klebsiella pneumoniae subsp. pneumoniae strain TGH8, complete 
genome
Length=5439720

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1722706  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  1722647

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  1722646  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  1722614


>gb|CP014696.1| Klebsiella quasipneumoniae strain ATCC 700603, complete genome
Length=5314161

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  4586451  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  4586510

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  4586511  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  4586543


>gb|CP014748.1| Enterobacter aerogenes strain FDAARGOS_139, complete genome
Length=5215775

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  489156  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  489215

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  489216  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  489248


>gb|CP011233.1| Salmonella enterica subsp. enterica serovar Typhimurium strain 
SL1344RX genome
Length=4882689

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2302676  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2302735

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2302736  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2302768


>gb|CP014358.1| Salmonella enterica subsp. enterica serovar Typhimurium strain 
YU15, complete genome
Length=4933574

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2434405  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2434464

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2434465  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2434497


>gb|CP014356.1| Salmonella enterica subsp. enterica serovar Typhimurium strain 
SO2, complete genome
Length=4916170

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2394105  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2394164

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2394165  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2394197


>gb|CP014536.1| Salmonella enterica subsp. enterica serovar Typhimurium strain 
SO3, complete genome
Length=4912959

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2390573  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2390632

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2390633  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2390665


>gb|CP011539.1| Enterobacter aerogenes strain G7, complete genome
Length=5452368

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  226221  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  226162

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  226161  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  226129


>gb|CP014029.1| Enterobacter aerogenes strain FDAARGOS_152, complete genome
Length=5317047

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1260905  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  1260964

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  1260965  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  1260997


>gb|CP014051.1| Salmonella enterica strain LT2, complete genome
Length=4857473

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  3290455  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  3290396

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  3290395  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  3290363


>emb|LN999997.1| Salmonella enterica subsp. enterica serovar Typhimurium isolate 
SO4698-09 genome assembly, chromosome: I
Length=5037238

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  3015797  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  3015738

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  3015737  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  3015705


>gb|CP014010.1| Klebsiella pneumoniae subsp. pneumoniae strain RJF999, complete 
genome
Length=5461919

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  3835492  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  3835551

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  3835552  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  3835584


>gb|CP014008.1| Klebsiella pneumoniae subsp. pneumoniae strain RJF293, complete 
genome
Length=5226330

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  3657158  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  3657217

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  3657218  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  3657250


>gb|CP014004.1| Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835, complete 
genome
Length=5387996

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  5224507  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  5224448

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  5224447  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  5224415


>gb|AE006468.2| Salmonella enterica subsp. enterica serovar Typhimurium str. 
LT2, complete genome
Length=4857450

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2366912  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2366971

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2366972  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2367004


>gb|CP013097.1| Salmonella enterica subsp. enterica serovar Enteritidis strain 
CMCC50041, complete genome
Length=4676329

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2317047  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2317106

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2317107  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2317139


>gb|CP013711.1| Klebsiella pneumoniae strain J1, complete genome
Length=5278493

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2950869  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  2950810

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2950809  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2950777


>gb|CP012043.1| Klebsiella pneumoniae strain U25 genome
Length=5491870

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  3993528  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  3993587

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  3993588  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  3993620


>gb|CP013322.1| Klebsiella pneumoniae strain CAV1193, complete genome
Length=5319154

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  3851737  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  3851678

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  3851677  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  3851645


>gb|CP012992.1| Klebsiella pneumoniae strain KpN06, complete genome
Length=5309013

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  4351905  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  4351846

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  4351845  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  4351813


>gb|CP012987.1| Klebsiella pneumoniae strain KpN01, complete genome
Length=5307114

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  4359178  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  4359119

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  4359118  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  4359086


>emb|LN824133.1| Klebsiella pneumoniae genome assembly MS6671.v1, chromosome : 
_Chr_Kpneumoniae_MS6671
Length=5402900

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  3723499  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  3723558

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  3723559  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  3723591


>gb|CP012144.1| Salmonella enterica subsp. enterica serovar Typhimurium strain 
FORC_020, complete genome
Length=4799793

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1579049  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  1578990

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1578989  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1578957


>gb|CP012930.1| Salmonella enterica subsp. enterica serovar Heidelberg strain 
N13-01290, complete genome
Length=4809628

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2367045  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2367104

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2367105  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2367137


>gb|CP012924.1| Salmonella enterica subsp. enterica serovar Heidelberg strain 
12-4374, complete genome
Length=4790331

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2367797  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2367856

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2367857  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2367889


>gb|CP012921.1| Salmonella enterica subsp. enterica serovar Heidelberg strain 
SA02DT10168701, complete genome
Length=4751447

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2367678  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2367737

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2367738  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2367770


>gb|CP012883.1| Klebsiella pneumoniae KP-1, complete genome
Length=5180925

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1030780  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  1030839

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  1030840  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  1030872


>gb|CP012833.1| Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001588, 
complete genome
Length=4651400

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1522662  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  1522603

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1522602  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1522570


>gb|CP012753.1| Klebsiella pneumoniae strain KP617, complete genome
Length=5416282

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  5254020  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  5253961

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  5253960  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  5253928


>gb|CP012514.1| Salmonella enterica subsp. enterica serovar Thompson strain RM1986, 
complete genome
Length=4701355

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2320812  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2320871

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2320872  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2320904


>gb|CP012513.1| Salmonella enterica subsp. enterica serovar Thompson strain RM1984, 
complete genome
Length=4708710

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2327642  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2327701

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2327702  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2327734


>gb|CP012681.1| Salmonella enterica subsp. enterica serovar Typhimurium strain 
33676, complete genome
Length=4809574

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2362734  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2362793

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2362794  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2362826


>dbj|AP014951.1| Klebsiella oxytoca DNA, complete genome, strain: JKo3
Length=5944658

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  4206861  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  4206920

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  4206921  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  4206953


>dbj|AP014950.1| Klebsiella pneumoniae DNA, complete genome, strain: YH43
Length=5520319

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1522529  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  1522470

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  1522469  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  1522437


>gb|CP012300.1| Klebsiella pneumoniae subsp. pneumoniae strain HKUOPLC, complete 
genome
Length=5088873

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1554904  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  1554845

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  1554844  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  1554812


>gb|CP012252.1| Klebsiella variicola strain HKUOPLA, complete genome
Length=5090052

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1280050  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  1280109

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  1280110  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  1280142


>gb|CP012349.1| Salmonella enterica subsp. enterica serovar Sloterdijk str. ATCC 
15791, complete genome
Length=4817791

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1545169  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  1545110

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1545109  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1545077


>gb|CP012347.1| Salmonella enterica subsp. enterica serovar Pullorum str. ATCC 
9120, complete genome
Length=4694842

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1557983  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  1557924

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1557923  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1557891


>gb|CP012344.1| Salmonella enterica subsp. enterica serovar Choleraesuis str. 
ATCC 10708, complete genome
Length=4824322

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1654207  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  1654148

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1654147  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1654115


>gb|CP007267.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120005, complete genome
Length=4679291

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2320059  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2320118

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2320119  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2320151


>gb|CP007329.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120002 genome
Length=4679418

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2320176  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2320235

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2320236  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2320268


>gb|CP007249.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20090641, complete genome
Length=4712309

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2321310  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2321369

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2321370  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2321402


>emb|LN868943.1| Salmonella enterica subsp. enterica serovar Senftenberg genome 
assembly NCTC10384, chromosome : 1
Length=3746274

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  964811  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  964752

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               |||||||||||||| ||||||||||||||||||
Sbjct  964751  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  964719


>gb|CP011636.1| Klebsiella oxytoca strain CAV1374, complete genome
Length=6257473

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2258229  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  2258170

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2258169  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2258137


>gb|CP011624.1| Klebsiella pneumoniae strain CAV1344, complete genome
Length=5262013

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  3831591  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  3831532

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  3831531  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  3831499


>gb|CP011618.1| Klebsiella oxytoca strain CAV1335, complete genome
Length=6229565

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  5481333  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  5481274

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  5481273  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  5481241


>gb|CP011597.1| Klebsiella oxytoca strain CAV1099, complete genome
Length=6217725

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  5455031  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  5454972

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  5454971  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  5454939


>gb|CP011574.1| Enterobacter aerogenes strain CAV1320, complete genome
Length=5124987

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  4807188  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  4807129

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  4807128  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  4807096


>gb|CP011428.1| Salmonella enterica subsp. enterica strain YU39, complete genome
Length=4886081

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2434846  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2434905

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2434906  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2434938


>gb|CP011421.1| Klebsiella pneumoniae strain yzusk-4 genome
Length=5081069

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2789982  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  2790041

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2790042  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2790074


>gb|CP011396.1| Salmonella enterica subsp. enterica serovar Thompson str. ATCC 
8391, complete genome
Length=4690430

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1576479  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  1576420

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1576419  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1576387


>gb|CP011365.1| Salmonella enterica subsp. enterica serovar Typhimurium strain 
FORC_015, complete genome
Length=4759372

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2308848  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2308907

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2308908  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2308940


>gb|CP011313.1| Klebsiella pneumoniae subsp. pneumoniae strain 234-12, complete 
genome
Length=5278254

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1569650  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  1569591

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  1569590  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  1569558


>gb|CP007559.1| Salmonella enterica subsp. enterica serovar Newport str. CDC 
2010K-2159, complete genome
Length=4790387

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1591248  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  1591189

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1591188  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1591156


>gb|CP007540.1| Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1921, 
complete genome
Length=4488371

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1587218  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  1587159

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1587158  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1587126


>gb|CP007523.1| Salmonella enterica subsp. enterica serovar Typhimurium str. 
CDC 2011K-0870, complete genome
Length=4769471

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  3099080  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  3099139

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  3099140  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  3099172


>gb|CP011259.1| Salmonella enterica subsp. enterica serovar Agona str. 460004 
2-1, complete genome
Length=4797171

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  4150318  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  4150377

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  4150378  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  4150410


>emb|LN829401.1| Salmonella enterica subsp. enterica serovar Typhimurium genome 
assembly NCTC13348, chromosome : 1
Length=3458333

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  518876  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  518817

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               |||||||||||||| ||||||||||||||||||
Sbjct  518816  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  518784


>gb|CP010283.1| Salmonella enterica subsp. enterica serovar Newport str. CVM 
21550, complete genome
Length=4858179

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1343117  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  1343058

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1343057  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1343025


>gb|CP010282.1| Salmonella enterica subsp. enterica serovar Newport str. CVM 
21538, complete genome
Length=4795842

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1456946  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  1456887

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1456886  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1456854


>gb|CP010281.1| Salmonella enterica subsp. enterica serovar Newport str. CVM 
22513, complete genome
Length=4830769

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  774821  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  774762

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               |||||||||||||| ||||||||||||||||||
Sbjct  774761  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  774729


>gb|CP010279.1| Salmonella enterica subsp. enterica serovar Newport str. CVM 
22425, complete genome
Length=4832938

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1951490  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  1951549

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1951550  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1951582


>gb|CP010284.1| Salmonella enterica subsp. enterica serovar Newport str. CVM 
N1543, complete genome
Length=4827959

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1      GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  15650  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  15709

Query  61     TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
              |||||||||||||| ||||||||||||||||||
Sbjct  15710  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  15742


>gb|CP007235.1| Salmonella enterica subsp. enterica serovar Typhimurium str. 
USDA-ARS-USMARC-1899, complete genome
Length=4856450

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  3138873  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  3138932

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  3138933  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  3138965


>gb|CP007222.1| Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1903, 
complete genome
Length=4565462

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2978663  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2978722

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2978723  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2978755


>gb|CP007216.1| Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1927, 
complete genome
Length=4695590

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  3051481  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  3051540

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  3051541  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  3051573


>gb|CP007211.1| Salmonella enterica subsp. enterica serovar Anatum str. CDC 06-0532, 
complete genome
Length=4667736

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  3084862  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  3084921

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  3084922  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  3084954


>gb|CP009084.2| Salmonella enterica subsp. enterica serovar Enteritidis strain 
OLF-SE2-98984-6, complete genome
Length=4679126

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2320171  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2320230

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2320231  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2320263


>gb|CP009085.2| Salmonella enterica subsp. enterica serovar Enteritidis strain 
OLF-SE3-98983-4, complete genome
Length=4679127

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2320172  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2320231

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2320232  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2320264


>gb|CP010523.1| Klebsiella variicola strain DSM 15968, complete genome
Length=5521203

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1567954  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  1568013

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  1568014  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  1568046


>gb|CP010280.1| Salmonella enterica subsp. enterica serovar Newport str. CVM 
22462, complete genome
Length=4864348

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1730019  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  1730078

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1730079  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1730111


>gb|CP006722.1| Klebsiella pneumoniae subsp. pneumoniae 1158, complete genome
Length=5341039

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1642492  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  1642433

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  1642432  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  1642400


>gb|CP009274.1| Klebsiella variicola strain DX120E, complete genome
Length=5501013

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  166035  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  166094

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  166095  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  166127


>emb|LN649235.1| Salmonella enterica subsp. enterica serovar Infantis genome assembly 
SINFA, chromosome : 1
Length=4710675

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2294748  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2294807

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2294808  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2294840


>gb|CP009876.1| Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31, complete 
genome
Length=5228295

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  3570989  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  3571048

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  3571049  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  3571081


>gb|CP009863.1| Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29, complete 
genome
Length=5298647

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  3721025  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  3721084

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  3721085  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  3721117


>gb|CP009461.1| Klebsiella pneumoniae strain XH209, complete genome
Length=5118878

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1299326  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  1299267

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  1299266  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  1299234


>gb|CP009565.1| Salmonella enterica subsp. enterica serovar Newport str. CVM 
21554, complete genome
Length=4726694

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  390625  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  390566

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               |||||||||||||| ||||||||||||||||||
Sbjct  390565  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  390533


>gb|CP009561.1| Salmonella enterica subsp. enterica serovar Newport str. CVM 
N18486, complete genome
Length=4755838

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  4271258  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  4271317

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  4271318  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  4271350


>gb|CP008929.1| Klebsiella pneumoniae strain PMK1, complete genome
Length=5317001

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  161968  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  162027

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  162028  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  162060


>gb|CP008928.1| Salmonella enterica subsp. enterica serovar Enteritidis strain 
SEJ, complete genome
Length=4678927

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  624781  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  624840

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               |||||||||||||| ||||||||||||||||||
Sbjct  624841  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  624873


>gb|CP009088.1| Salmonella enterica subsp. enterica serovar Enteritidis strain 
OLF-SE6-00219-16, complete genome
Length=4677619

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2319954  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2320013

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2320014  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2320046


>gb|CP009083.1| Salmonella enterica subsp. enterica serovar Enteritidis strain 
OLF-SE1-1019-1, complete genome
Length=4678914

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2320167  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2320226

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2320227  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2320259


>gb|CP009087.1| Salmonella enterica subsp. enterica serovar Enteritidis strain 
OLF-SE5-1104-2, complete genome
Length=4678571

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2319419  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2319478

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2319479  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2319511


>gb|CP009086.1| Salmonella enterica subsp. enterica serovar Enteritidis strain 
OLF-SE4-0317-8, complete genome
Length=4678377

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2319601  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2319660

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2319661  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2319693


>gb|CP009093.1| Salmonella enterica subsp. enterica serovar Enteritidis strain 
OLF-SE11-10058, complete genome
Length=4702741

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2311816  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2311875

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2311876  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2311908


>gb|CP009092.1| Salmonella enterica subsp. enterica serovar Enteritidis strain 
OLF-SE10-10052, complete genome
Length=4709890

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2320374  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2320433

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2320434  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2320466


>gb|CP009091.1| Salmonella enterica subsp. enterica serovar Enteritidis strain 
OLF-SE9-10012, complete genome
Length=4671261

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2348925  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2348984

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2348985  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2349017


>gb|CP009089.1| Salmonella enterica subsp. enterica serovar Enteritidis strain 
OLF-SE7-100819, complete genome
Length=4710936

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2321323  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2321382

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2321383  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2321415


>gb|CP007639.1| Salmonella enterica subsp. enterica serovar Choleraesuis strain 
C500, complete genome
Length=4751585

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2378575  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2378634

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2378635  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2378667


>gb|CP009208.1| Klebsiella pneumoniae subsp. pneumoniae strain ATCC 43816 KPPR1, 
complete genome
Length=5374834

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  5018318  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  5018259

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  5018258  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  5018226


>gb|CP007804.2| Salmonella enterica subsp. enterica serovar Typhimurium strain 
VNP20009, complete genome
Length=4763557

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2309080  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2309139

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2309140  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2309172


>gb|CP006798.1| Klebsiella pneumoniae subsp. pneumoniae PittNDM01, complete genome
Length=5348284

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  5199909  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  5199850

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  5199849  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  5199817


>gb|CP008841.1| Klebsiella oxytoca strain M1, complete genome
Length=5865090

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  5170885  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  5170944

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  5170945  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  5170977


>emb|LK931482.1| Salmonella enterica subsp. enterica serovar Pullorum genome assembly 
S44987_1 ,chromosome : I
Length=4620579

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2270442  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2270501

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2270502  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2270534


>dbj|AP014565.1| Salmonella enterica subsp. enterica serovar Typhimurium str. 
L-3553 DNA, complete genome
Length=5051841

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2533447  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2533506

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2533507  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2533539


>gb|CP008788.1| Klebsiella oxytoca KONIH1, complete genome
Length=6152190

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  4265581  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  4265640

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  4265641  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  4265673


>gb|CP008700.1| Klebsiella pneumoniae subsp. pneumoniae KP5-1, complete genome
Length=5365144

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  659712  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  659771

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  659772  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  659804


>gb|CP006692.1| Salmonella bongori serovar 48:z41:-- str. RKS3044, complete genome
Length=4394500

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2144193  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2144252

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||| |||| ||||||||||||||||||
Sbjct  2144253  TTTCAACCGAATGCTTCGCATTCGGTTTTTTTT  2144285


>gb|CP007731.1| Klebsiella pneumoniae subsp. pneumoniae KPNIH27, complete genome
Length=5241638

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  3658028  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  3658087

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  3658088  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  3658120


>gb|CP007598.1| Salmonella enterica subsp. enterica serovar Enteritidis str. 
77-1427, complete genome
Length=4679081

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  3931142  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  3931201

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  3931202  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  3931234


>gb|CP007581.1| Salmonella enterica subsp. enterica serovar Typhimurium strain 
138736, complete genome
Length=4933618

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2434427  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2434486

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2434487  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2434519


>gb|CP004887.1| Klebsiella oxytoca HKOPL1, complete genome
Length=5914407

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2428940  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  2428881

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2428880  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2428848


>gb|CP007528.1| Salmonella enterica subsp. enterica serovar Enteritidis str. 
CDC_2010K_0968, complete genome
Length=4679662

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1943381  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  1943322

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1943321  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1943289


>gb|CP007534.1| Salmonella enterica subsp. enterica serovar Abony str. 0014, 
complete genome
Length=4737447

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  4299027  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  4299086

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  4299087  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  4299119


>gb|CP007533.1| Salmonella enterica subsp. enterica serovar Bredeney str. CFSAN001080, 
complete genome
Length=4603849

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1872594  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  1872653

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1872654  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1872686


>gb|CP007532.1| Salmonella enterica subsp. enterica serovar Abaetetuba str. ATCC 
35640, complete genome
Length=4547600

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  4105148  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  4105207

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  4105208  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  4105240


>gb|CP007531.1| Salmonella enterica subsp. enterica serovar Anatum str. ATCC 
BAA-1592, complete genome
Length=4706101

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  4692670  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  4692611

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  4692610  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  4692578


>gb|CP007530.1| Salmonella enterica subsp. enterica serovar Montevideo str. 507440-20, 
complete genome
Length=4694375

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1965710  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  1965769

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1965770  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1965802


>gb|CP007507.1| Salmonella enterica subsp. enterica serovar Enteritidis strain 
Durban, complete genome
Length=4678926

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2320034  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2320093

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2320094  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2320126


>gb|CP007248.1| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20090698, complete genome
Length=4680996

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2318777  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2318836

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2318837  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2318869


>gb|CP007247.1| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20110221, complete genome
Length=4709033

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2314283  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2314342

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2314343  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2314375


>gb|CP007246.1| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20100101, complete genome
Length=4654156

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2315671  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2315730

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2315731  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2315763


>gb|CP007245.1| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120008, complete genome
Length=4711924

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2317601  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2317660

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2317661  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2317693


>gb|CP007175.1| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20110354, complete genome
Length=4711160

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2316064  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2316123

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2316124  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2316156


>gb|CP007253.1| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20111174, complete genome
Length=4683803

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2319772  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2319831

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2319832  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2319864


>gb|CP007252.1| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20111175, complete genome
Length=4679808

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2315968  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2316027

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2316028  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2316060


>gb|CP007251.1| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20110353, complete genome
Length=4710452

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2315852  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2315911

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2315912  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2315944


>gb|CP007250.1| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20110355, complete genome
Length=4681839

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2319375  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2319434

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2319435  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2319467


>gb|CP007254.1| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20111095, complete genome
 gb|CP007269.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20121175, complete genome
Length=4679953

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2316019  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2316078

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2316079  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2316111


>gb|CP007332.1| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120916 genome
Length=4807994

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  3973000  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  3973059

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  3973060  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  3973092


>gb|CP007262.1| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20110356, complete genome
Length=4682805

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2319957  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2320016

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2320017  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2320049


>gb|CP007261.1| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20110357, complete genome
Length=4678418

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2324579  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2324638

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2324639  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2324671


>gb|CP007260.1| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20110358, complete genome
Length=4678687

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2315650  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2315709

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2315710  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2315742


>gb|CP007259.1| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20110359, complete genome
Length=4711474

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2316462  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2316521

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2316522  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2316554


>gb|CP007258.1| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20110360, complete genome
Length=4678618

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2315553  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2315612

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2315613  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2315645


>gb|CP007263.1| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20110361, complete genome
Length=4682911

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2319268  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2319327

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2319328  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2319360


>gb|CP007505.1| Salmonella enterica subsp. enterica serovar Tennessee str. TXSC_TXSC08-19, 
complete genome
Length=4864410

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  3832008  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  3832067

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  3832068  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  3832100


>emb|FO834906.1| Klebsiella pneumoniae str. Kp52.145, chromosome, complete genome
Length=5438894

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  4063153  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  4063212

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  4063213  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  4063245


>gb|CP003999.1| Klebsiella pneumoniae subsp. pneumoniae Kp13, complete genome
Length=5307003

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1585606  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  1585547

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  1585546  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  1585514


>gb|CP005995.1| Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002064, 
complete genome
Length=4783867

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  925482  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  925541

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               |||||||||||||| ||||||||||||||||||
Sbjct  925542  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  925574


>gb|CP006876.1| Salmonella enterica subsp. enterica serovar Agona str. 24249, 
complete genome
Length=4762840

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2317927  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2317986

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2317987  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2318019


>gb|CP005390.2| Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069, 
complete genome
Length=4783943

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2847167  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2847226

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2847227  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2847259


>emb|HG326213.1| Salmonella enterica subsp. enterica serovar Typhimurium str. 
DT2, complete genome
Length=4814801

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2356803  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2356862

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2356863  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2356895


>gb|CP006717.1| Salmonella enterica subsp. enterica serovar Thompson str. RM6836, 
complete genome
Length=4707648

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2327239  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2327298

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2327299  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2327331


>emb|HF937208.1| Salmonella enterica subsp. enterica serovar Typhimurium DT104 
main chromosome, complete genome
Length=4933631

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2434393  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2434452

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2434453  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2434485


>gb|CP003786.1| Salmonella enterica subsp. enterica serovar Gallinarum/pullorum 
str. CDC1983-67, complete genome
Length=4623089

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  683003  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  682944

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               |||||||||||||| ||||||||||||||||||
Sbjct  682943  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  682911


>gb|CP006575.1| Salmonella enterica subsp. enterica serovar Pullorum str. S06004, 
complete genome
Length=4682599

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  682933  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  682874

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               |||||||||||||| ||||||||||||||||||
Sbjct  682873  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  682841


>gb|CP006631.1| Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1, 
complete genome
Length=4915960

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  3394274  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  3394333

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  3394334  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  3394366


>gb|CP006608.1| Salmonella bongori N268-08, complete genome
Length=4683551

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2368624  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2368683

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||| |||| ||||||||||||||||||
Sbjct  2368684  TTTCAACCGAATGCTTCGCATTCGGTTTTTTTT  2368716


>gb|CP006602.1| Salmonella enterica subsp. enterica serovar Typhimurium str. 
08-1736, complete genome
Length=4822189

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  3653992  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  3654051

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  3654052  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  3654084


>gb|CP006055.1| Salmonella enterica subsp. enterica Serovar Cubana str. CFSAN002050, 
complete genome
Length=4977480

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  3409685  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  3409744

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  3409745  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  3409777


>gb|CP006053.1| Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000189, 
complete genome
Length=4730612

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1665325  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  1665266

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1665265  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1665233


>gb|CP006048.1| Salmonella enterica subsp. enterica serovar Typhimurium var. 
5- str. CFSAN001921, complete genome
Length=4859931

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1149157  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  1149098

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1149097  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1149065


>gb|CP004086.1| Salmonella enterica subsp. enterica serovar Heidelberg str. 41578, 
complete genome
Length=4793479

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  4162996  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  4163055

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  4163056  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  4163088


>emb|FO203501.1| Klebsiella pneumoniae subsp. rhinoscleromatis strain SB3432, 
complete genome
Length=5270770

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2173820  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  2173761

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2173760  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2173728


>gb|CP003836.1| Salmonella enterica subsp. enterica serovar Typhimurium str. 
U288, complete genome
Length=4852606

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1580354  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  1580413

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1580414  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1580446


>gb|CP004027.1| Salmonella enterica subsp. enterica serovar Javiana str. CFSAN001992, 
complete genome
Length=4634161

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  4616124  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  4616065

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  4616064  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  4616032


>emb|FO203355.1| Enterobacter aerogenes EA1509E complete genome
Length=5419609

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  180618  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  180559

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||||||||| |||||||||||
Sbjct  180558  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  180526


>gb|CP003683.1| Klebsiella oxytoca E718, complete genome
Length=6097032

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  4347959  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  4348018

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  4348019  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  4348051


>gb|CP003416.1| Salmonella enterica subsp. enterica serovar Heidelberg str. B182, 
complete genome
Length=4750465

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  3102571  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  3102630

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  3102631  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  3102663


>gb|CP003386.1| Salmonella enterica subsp. enterica serovar Typhimurium str. 
798, complete genome
Length=4876219

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2363993  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2364052

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2364053  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2364085


>gb|CP003218.1| Klebsiella oxytoca KCTC 1686, complete genome
Length=5974109

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  5636436  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  5636495

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  5636496  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  5636528


>gb|CP003047.1| Salmonella enterica subsp. enterica serovar Gallinarum/pullorum 
str. RKS5078, complete genome
Length=4637962

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  683044  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  682985

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               |||||||||||||| ||||||||||||||||||
Sbjct  682984  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  682952


>gb|CP002910.1| Klebsiella pneumoniae KCTC 2242, complete genome
Length=5259571

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  3403360  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  3403419

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  3403420  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  3403452


>emb|FR877557.1| Salmonella bongori NCTC 12419, culture collection SGSC SARC11, 
complete genome
Length=4460105

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2251075  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2251134

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||| |||| ||||||||||||||||||
Sbjct  2251135  TTTCAACCGAATGCTTCGCATTCGGTTTTTTTT  2251167


>gb|CP002824.1| Enterobacter aerogenes KCTC 2190, complete genome
Length=5280350

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  5155288  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  5155347

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  5155348  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  5155380


>gb|CP002614.1| Salmonella enterica subsp. enterica serovar Typhimurium str. 
UK-1, complete genome
Length=4817868

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2366658  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2366717

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2366718  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2366750


>gb|GU461279.1| Klebsiella pneumoniae strain NVT2001 putative 2-component sensor 
protein (yojN) gene, partial cds; outer membrane porin (ompK36) 
gene, complete cds; and putative thiamine biosynthesis 
lipoprotein (yojL) gene, partial cds
Length=3317

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1    GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
            |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  807  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  748

Query  61   TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
            ||||||||||||||||||||| |||||||||||
Sbjct  747  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  715


>gb|CP002487.1| Salmonella enterica subsp. enterica serovar Typhimurium str. 
ST4/74, complete genome
Length=4878013

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2364629  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2364688

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2364689  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2364721


>dbj|AP011957.1| Salmonella enterica subsp. enterica serovar Typhimurium str. 
T000240 DNA, complete genome
Length=4954814

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2362456  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2362515

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2362516  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2362548


>emb|FQ312003.1| Salmonella enterica subsp. enterica serovar Typhimurium SL1344 
complete genome
Length=4878012

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2364629  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2364688

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2364689  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2364721


>gb|CP001891.1| Klebsiella variicola At-22, complete genome
Length=5458505

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1505262  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  1505203

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  1505202  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  1505170


>gb|CP001363.1| Salmonella enterica subsp. enterica serovar Typhimurium str. 
14028S, complete genome
Length=4870265

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2418466  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2418525

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2418526  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2418558


>emb|FN424405.1| Salmonella enterica subsp. enterica serovar Typhimurium str. 
D23580 complete genome
Length=4879400

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2390579  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2390638

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2390639  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2390671


>dbj|AP006725.1| Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 DNA, complete 
genome
Length=5248520

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  3700195  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  3700254

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  3700255  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  3700287


>gb|CP000964.1| Klebsiella pneumoniae 342, complete genome
Length=5641239

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1542575  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  1542516

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  1542515  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  1542483


>gb|EF191076.2| Enterobacter aerogenes strain C1 OmpE36 (ompE36) gene, complete 
cds
Length=2276

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1    GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
            |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  197  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  138

Query  61   TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
            ||||||||||||||||||||| |||||||||||
Sbjct  137  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  105


>emb|AM933173.1| Salmonella enterica subsp. enterica serovar Gallinarum str. 287/91 
complete genome
Length=4658697

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2351849  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2351908

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2351909  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2351941


>gb|CP001138.1| Salmonella enterica subsp. enterica serovar Agona str. SL483, 
complete genome
Length=4798660

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2318396  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2318455

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2318456  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2318488


>gb|CP001127.1| Salmonella enterica subsp. enterica serovar Schwarzengrund str. 
CVM19633, complete genome
Length=4709075

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2372691  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2372750

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2372751  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2372783


>gb|CP001120.1| Salmonella enterica subsp. enterica serovar Heidelberg str. SL476, 
complete genome
Length=4888768

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2414476  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2414535

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2414536  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2414568


>gb|CP001113.1| Salmonella enterica subsp. enterica serovar Newport str. SL254, 
complete genome
Length=4827641

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2368676  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2368735

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2368736  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2368768


>gb|CP000886.1| Salmonella enterica subsp. enterica serovar Paratyphi B str. 
SPB7, complete genome
Length=4858887

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  678936  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  678877

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               |||||||||||||| ||||||||||||||||||
Sbjct  678876  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  678844


>gb|CP000647.1| Klebsiella pneumoniae subsp. pneumoniae MGH 78578, complete genome
Length=5315120

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2896241  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  2896300

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2896301  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2896333


>gb|S75172.1| ompC=outer membrane protein C, micF=regulatory RNA gene {regulatory 
region} [Salmonella typhimurium, 815, Genomic, 358 nt]
Length=358

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1    GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
            |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  266  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  325

Query  61   TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
            |||||||||||||| ||||||||||||||||||
Sbjct  326  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  358


>gb|AE017220.1| Salmonella enterica subsp. enterica serovar Choleraesuis str. 
SC-B67, complete genome
Length=4755700

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2381197  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2381256

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2381257  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2381289


>gb|AF039309.1|AF039309 Salmonella typhimurium outer membrane porin C (ompC) gene, complete 
cds
Length=1629

 Score =  161 bits (87),  Expect = 1e-36
 Identities = 91/93 (97%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1   GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  93  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  34

Query  61  TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
           |||||||||||||| ||||||||||||||||||
Sbjct  33  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1


>emb|LT216436.1| Klebsiella pneumoniae isolate 207M1D0-sc-2013-04-03T11:21:06Z-1606409 
genome assembly, chromosome: 1
Length=5476690

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  3825892  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  3825833

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||| ||||||||||
Sbjct  3825832  TTTCAACCGGATGCCTCGCATCCGGTTTTTTT  3825801


>gb|CP007468.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20094177 genome
Length=4685839

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007323.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20110222 genome
Length=4686198

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2361330  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361389

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361390  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361421


>gb|CP007339.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120685 genome
Length=4685833

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360979  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361038

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361039  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361070


>gb|CP007344.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120213 genome
Length=4685846

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360979  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361038

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361039  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361070


>gb|CP007378.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120968 genome
Length=4686258

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007412.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20122022 genome
Length=4685847

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360979  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361038

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361039  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361070


>gb|CP007425.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20082034, complete genome
Length=4685659

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007325.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20111515 genome
Length=4685847

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007498.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20111510 genome
Length=4685842

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007469.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20094301 genome
Length=4685835

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007467.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20084824 genome
Length=4685836

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007466.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20084644 genome
Length=4685836

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007464.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20121747 genome
Length=4685731

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360922  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2360981

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2360982  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361013


>gb|CP007463.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120929 genome
Length=4685736

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360874  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2360933

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2360934  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2360965


>gb|CP007438.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120009 genome
Length=4685849

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007433.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120051 genome
Length=4685846

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360979  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361038

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361039  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361070


>gb|CP007429.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20121765 genome
Length=4685848

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007428.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120677 genome
Length=4685846

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360979  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361038

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361039  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361070


>gb|CP007427.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20100239 genome
Length=4685849

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007432.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20100131 genome
Length=4685847

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007431.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20094682 genome
Length=4685841

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007430.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20090195 genome
Length=4685846

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360979  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361038

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361039  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361070


>gb|CP007426.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20085285, complete genome
Length=4685834

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2361155  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361214

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361215  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361246


>gb|CP007404.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120774 genome
Length=4685845

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007401.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120738 genome
Length=4685847

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007368.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20121542 genome
Length=4685840

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007367.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20121541 genome
Length=4685975

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007366.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20121004 genome
Length=4685832

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007373.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20121744 genome
Length=4685838

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007372.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20121703 genome
Length=4685840

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007371.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20121689 genome
Length=4685786

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007370.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20121672 genome
Length=4685833

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007369.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20121671 genome
Length=4685835

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007422.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20090531 genome
Length=4685834

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007421.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20090884 genome
Length=4685838

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007420.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20100103 genome
Length=4685835

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007434.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120200, complete genome
Length=4685848

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007424.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20130348 genome
Length=4685849

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360979  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361038

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361039  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361070


>gb|CP007423.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20130347 genome
Length=4685847

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360979  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361038

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361039  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361070


>gb|CP007419.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20130346 genome
Length=4685836

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007418.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20130345 genome
Length=4685849

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007417.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20123395 genome
Length=4685793

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360925  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2360984

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2360985  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361016


>gb|CP007416.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20122045 genome
Length=4685841

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007415.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20122033 genome
Length=4685839

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007354.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120528 genome
Length=4685835

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007361.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20100349 genome
Length=4685835

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360979  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361038

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361039  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361070


>gb|CP007359.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20100134 genome
Length=4685849

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007358.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20100130 genome
Length=4685849

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007357.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20100100 genome
Length=4685841

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007382.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20121825 genome
Length=4685838

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007381.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20121812 genome
Length=4685847

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007380.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120970 genome
Length=4685838

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007379.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120969 genome
Length=4685833

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007377.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120963 genome
Length=4685843

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007376.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120927 genome
Length=4685848

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007365.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120994 genome
Length=4686395

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007311.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20094350 genome
Length=4685841

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007310.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20094079 genome
Length=4685841

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007309.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20093977 genome
Length=4685844

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007308.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20093950 genome
Length=4685842

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007307.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20093788 genome
Length=4685841

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360979  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361038

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361039  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361070


>gb|CP007334.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20092320 genome
Length=4685836

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007333.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20121177, complete genome
Length=4685848

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007364.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120555 genome
Length=4685846

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360978  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361037

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361038  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361069


>gb|CP007363.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120548 genome
Length=4685901

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007362.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120544 genome
Length=4685841

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007396.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20121750 genome
Length=4685838

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360979  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361038

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361039  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361070


>gb|CP007374.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20121746 genome
Length=4685847

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007375.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120925 genome
Length=4685848

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007405.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120775 genome
Length=4685845

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007360.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20100325 genome
Length=4685849

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007353.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120505 genome
Length=4685834

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360979  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361038

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361039  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361070


>gb|CP007352.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120498 genome
Length=4685833

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007351.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120497 genome
Length=4685848

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007350.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120496 genome
Length=4685847

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007349.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120469 genome
Length=4685845

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007348.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120356 genome
Length=4686185

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360906  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2360965

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2360966  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2360997


>gb|CP007347.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120240 genome
Length=4685839

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007346.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120229 genome
Length=4685832

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007345.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120219 genome
Length=4685842

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007340.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120686 genome
Length=4685835

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360979  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361038

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361039  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361070


>gb|CP007338.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120597 genome
Length=4685845

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007336.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120581 genome
Length=4685843

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360979  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361038

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361039  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361070


>gb|CP007335.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120580 genome
Length=4685833

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007328.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20111576 genome
Length=4685845

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360978  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361037

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361038  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361069


>gb|CP007326.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20111554 genome
Length=4685846

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360979  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361038

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361039  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361070


>gb|CP007324.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20111514 genome
Length=4685845

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007319.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20095440, complete genome
Length=4685849

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007314.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20094389 genome
Length=4685842

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007313.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20094383 genome
Length=4685848

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007312.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20094352 complete genome
Length=4685849

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007306.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20093784 genome
Length=4685844

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007305.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20093543 genome
Length=4685907

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007304.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20093538 genome
Length=4685845

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007303.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20093430 genome
Length=4685905

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007302.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20093421 genome
Length=4685836

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007356.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20100089 genome
Length=4685847

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007355.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20100088 genome
Length=4685845

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360978  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361037

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361038  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361069


>gb|CP007298.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20090530 genome
Length=4685841

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007297.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20090435 genome
Length=4685841

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007296.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20090419 genome
Length=4685839

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007286.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA19981522, complete genome
Length=4685848

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007285.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA19980677, complete genome
Length=4685849

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007283.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA19970769, complete genome
Length=4685848

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007291.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA19992322 genome
Length=4685849

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007290.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA19983126 genome
Length=4685848

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007289.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA19982831 genome
Length=4685775

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007288.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA19981857, complete genome
Length=4685848

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360979  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361038

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361039  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361070


>gb|CP007277.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA19930684 genome
Length=4685848

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007295.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20084384 genome
Length=4686394

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007294.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20083636, complete genome
Length=4685658

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007293.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20083456 genome
Length=4685838

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007292.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA19994216, complete genome
Length=4685847

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007282.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA19970510, complete genome
Length=4685847

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360979  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361038

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361039  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361070


>gb|CP007281.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA19961622 genome
Length=4685848

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007280.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA19960848, complete genome
Length=4685848

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007279.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA19943269 genome
Length=4685848

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007278.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA19942384 genome
Length=4685847

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007301.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20091739 genome
Length=4685841

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007300.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20090877 genome
Length=4685839

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360979  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361038

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361039  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361070


>gb|CP007274.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20093266 genome
Length=4685841

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007273.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20121180 genome
Length=4685848

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007272.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20121179 genome
Length=4685848

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007271.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20121178, complete genome
Length=4685848

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007270.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20121176 genome
Length=4685848

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007414.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20122031 genome
Length=4685880

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007413.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20122026 genome
Length=4685785

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007411.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20121990 genome
Length=4685848

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007284.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA19971331 genome
Length=4685849

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007266.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20110223 genome
Length=4685848

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007408.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120918 genome
Length=4685848

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007407.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120917 genome
Length=4685847

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360979  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361038

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361039  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361070


>gb|CP007406.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120776 genome
Length=4685836

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007403.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120773 genome
Length=4685845

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360979  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361038

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361039  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361070


>gb|CP007402.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120765 genome
Length=4685984

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007400.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120734 genome
Length=4686021

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2361155  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361214

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361215  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361246


>gb|CP007398.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20121753 genome
Length=4685844

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007397.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20121751 genome
Length=4685843

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360979  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361038

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361039  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361070


>gb|CP007395.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20121748 genome
Length=4685847

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007388.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20121989 genome
Length=4685848

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007387.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20121986 genome
Length=4685785

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360917  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2360976

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2360977  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361008


>gb|CP007386.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20121976 genome
Length=4685839

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007385.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20121970 genome
Length=4685838

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007384.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20121969 genome
Length=4685842

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007383.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20121826 genome
Length=4685698

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360838  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2360897

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2360898  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2360929


>gb|CP007343.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120722 genome
Length=4685843

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007342.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120697 genome
Length=4685838

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007341.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120687 genome
Length=4685832

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007331.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120007 genome
Length=4685849

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007330.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120003 genome
Length=4685974

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007327.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20111561 genome
Length=4685848

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007322.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20090332 genome
Length=4685850

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007321.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20090193 genome
Length=4685850

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007320.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20090135 genome
Length=4686535

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007318.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20095309 genome
Length=4685844

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007317.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20094803 genome
Length=4685843

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007316.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20094642 genome
Length=4685844

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360979  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361038

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361039  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361070


>gb|CP007315.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA20094521 genome
Length=4685836

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP007337.2| Salmonella enterica subsp. enterica serovar Enteritidis str. 
EC20120590 genome
Length=4685840

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|CP006659.2| Klebsiella pneumoniae strain ATCC BAA-2146 chromosome 1, complete 
sequence
Length=5435746

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  3756891  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  3756950

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||| ||||||||||
Sbjct  3756951  TTTCAACCGGATGCCTCGCATCCGGTTTTTTT  3756982


>gb|CP009768.1| Salmonella enterica subsp. enterica serovar Enteritidis strain 
FORC_007, complete genome
Length=4680477

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  3240034  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  3240093

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  3240094  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  3240125


>gb|CP012151.1| Salmonella enterica subsp. enterica serovar Typhi strain B/SF/13/03/195, 
complete genome
Length=4798993

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  3444682  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  3444741

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  3444742  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  3444773


>gb|CP012091.1| Salmonella enterica subsp. enterica serovar Typhi strain PM016/13, 
complete genome
Length=4793553

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  4483240  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  4483181

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  4483180  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  4483149


>gb|CP011989.1| Klebsiella pneumoniae UHKPC33, complete genome
Length=5329725

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1567877  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  1567818

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||| ||||||||||
Sbjct  1567817  TTTCAACCGGATGCCTCGCATCCGGTTTTTTT  1567786


>gb|CP011985.1| Klebsiella pneumoniae UHKPC07, complete genome
Length=5322270

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1569100  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  1569041

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||| ||||||||||
Sbjct  1569040  TTTCAACCGGATGCCTCGCATCCGGTTTTTTT  1569009


>gb|CP011976.1| Klebsiella pneumoniae DMC1097, complete genome
Length=5393855

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1616405  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  1616346

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||| ||||||||||
Sbjct  1616345  TTTCAACCGGATGCCTCGCATCCGGTTTTTTT  1616314


>gb|CP011980.1| Klebsiella pneumoniae 500_1420, complete genome
Length=5308211

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1548823  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  1548764

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||| ||||||||||
Sbjct  1548763  TTTCAACCGGATGCCTCGCATCCGGTTTTTTT  1548732


>gb|CP011791.1| Salmonella enterica subsp. enterica serovar Enteritidis strain 
SEE2, complete genome
Length=4677830

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2319741  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2319800

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2319801  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2319832


>gb|CP011790.1| Salmonella enterica subsp. enterica serovar Enteritidis strain 
SEE1, complete genome
Length=4678365

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2319855  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2319914

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2319915  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2319946


>gb|CP011647.1| Klebsiella pneumoniae strain CAV1596, complete genome
Length=5402147

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  4942888  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  4942947

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||| ||||||||||
Sbjct  4942948  TTTCAACCGGATGCCTCGCATCCGGTTTTTTT  4942979


>gb|CP011578.1| Klebsiella pneumoniae strain CAV1392, complete genome
Length=5328319

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1846084  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  1846143

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||| ||||||||||
Sbjct  1846144  TTTCAACCGGATGCCTCGCATCCGGTTTTTTT  1846175


>gb|CP011394.1| Salmonella enterica subsp. enterica serovar Enteritidis str. 
18569, complete genome
Length=4685993

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1558834  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  1558775

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  1558774  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  1558743


>gb|CP010361.1| Klebsiella pneumoniae strain 32192, complete genome
Length=5344430

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1565430  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  1565371

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||| ||||||||||
Sbjct  1565370  TTTCAACCGGATGCCTCGCATCCGGTTTTTTT  1565339


>gb|CP010392.1| Klebsiella pneumoniae strain 34618, complete genome
Length=5313576

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1565255  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  1565196

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||| ||||||||||
Sbjct  1565195  TTTCAACCGGATGCCTCGCATCCGGTTTTTTT  1565164


>gb|CP009872.1| Klebsiella pneumoniae subsp. pneumoniae strain KPNIH30, complete 
genome
Length=5306618

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  3709383  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  3709442

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||| ||||||||||
Sbjct  3709443  TTTCAACCGGATGCCTCGCATCCGGTTTTTTT  3709474


>gb|CP009775.1| Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32, complete 
genome
Length=5515525

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  3832525  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  3832584

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||| ||||||||||
Sbjct  3832585  TTTCAACCGGATGCCTCGCATCCGGTTTTTTT  3832616


>gb|CP009771.1| Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33, complete 
genome
Length=5574202

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  3884417  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  3884476

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||| ||||||||||
Sbjct  3884477  TTTCAACCGGATGCCTCGCATCCGGTTTTTTT  3884508


>gb|CP009090.1| Salmonella enterica subsp. enterica serovar Enteritidis strain 
OLF-SE8-1021710, complete genome
Length=4667283

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2319668  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2319727

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2319728  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2319759


>gb|CP009102.1| Salmonella enterica subsp. enterica serovar Typhimurium strain 
ATCC 13311, complete genome
Length=4793299

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2335086  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2335145

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2335146  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2335177


>gb|CP009114.1| Klebsiella pneumoniae strain blaNDM-1, complete genome
Length=5297511

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1905951  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  1906010

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||| ||||||||||
Sbjct  1906011  TTTCAACCGGATGCCTCGCATCCGGTTTTTTT  1906042


>gb|CP008831.1| Klebsiella pneumoniae subsp. pneumoniae KPR0928, complete sequence
Length=5309305

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  3711982  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  3712041

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||| ||||||||||
Sbjct  3712042  TTTCAACCGGATGCCTCGCATCCGGTTTTTTT  3712073


>gb|CP008827.1| Klebsiella pneumoniae subsp. pneumoniae KPNIH1, complete genome
Length=5394056

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  3714390  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  3714449

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||| ||||||||||
Sbjct  3714450  TTTCAACCGGATGCCTCGCATCCGGTTTTTTT  3714481


>gb|CP008797.1| Klebsiella pneumoniae subsp. pneumoniae KPNIH24, complete genome
Length=5396164

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2100847  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  2100788

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||| ||||||||||
Sbjct  2100787  TTTCAACCGGATGCCTCGCATCCGGTTTTTTT  2100756


>gb|CP007727.1| Klebsiella pneumoniae subsp. pneumoniae KPNIH10, complete genome
Length=5395263

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  3715593  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  3715652

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||| ||||||||||
Sbjct  3715653  TTTCAACCGGATGCCTCGCATCCGGTTTTTTT  3715684


>gb|CP006923.1| Klebsiella pneumoniae 30660/NJST258_1, complete genome
Length=5263229

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1644990  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  1644931

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||| ||||||||||
Sbjct  1644930  TTTCAACCGGATGCCTCGCATCCGGTTTTTTT  1644899


>gb|CP006918.1| Klebsiella pneumoniae 30684/NJST258_2, complete genome
Length=5293301

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1647652  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  1647593

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||| ||||||||||
Sbjct  1647592  TTTCAACCGGATGCCTCGCATCCGGTTTTTTT  1647561


>gb|CP006656.1| Klebsiella pneumoniae JM45, complete genome
Length=5273813

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1641896  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  1641837

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||| ||||||||||
Sbjct  1641836  TTTCAACCGGATGCCTCGCATCCGGTTTTTTT  1641805


>emb|AL513382.1| Salmonella enterica subsp. enterica serovar Typhi str. CT18, 
complete chromosome
Length=4809037

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2323864  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2323923

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2323924  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2323955


>gb|CP003785.1| Klebsiella pneumoniae subsp. pneumoniae 1084, complete genome
Length=5386705

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1515810  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  1515751

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||| ||||||||||
Sbjct  1515750  TTTCAACCGGATGCCTCGCATCCGGTTTTTTT  1515719


>gb|CP003278.1| Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12, 
complete genome
Length=4768352

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  680803  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  680744

Query  61      TTTCAACCGGATGCCTCGCATTCGGttttttt  92
               |||||||||||||| |||||||||||||||||
Sbjct  680743  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  680712


>gb|CP003200.1| Klebsiella pneumoniae subsp. pneumoniae HS11286, complete genome
Length=5333942

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  3729315  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  3729374

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                ||||||||||||||||||||| ||||||||||
Sbjct  3729375  TTTCAACCGGATGCCTCGCATCCGGTTTTTTT  3729406


>gb|CP000857.1| Salmonella enterica subsp. enterica serovar Paratyphi C strain 
RKS4594, complete genome
Length=4833080

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1513418  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  1513359

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  1513358  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  1513327


>emb|AM933172.1| Salmonella enterica subsp. enterica serovar Enteritidis str. 
P125109 complete genome
Length=4685848

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2360980  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361039

Query  61       TTTCAACCGGATGCCTCGCATTCGGttttttt  92
                |||||||||||||| |||||||||||||||||
Sbjct  2361040  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  2361071


>gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi Ty2, complete 
genome
Length=4791961

 Score =  159 bits (86),  Expect = 5e-36
 Identities = 90/92 (97%), Gaps = 0/92 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  680849  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  680790

Query  61      TTTCAACCGGATGCCTCGCATTCGGttttttt  92
               |||||||||||||| |||||||||||||||||
Sbjct  680789  TTTCAACCGGATGCTTCGCATTCGGTTTTTTT  680758


>emb|LT571437.1| Salmonella enterica subsp. enterica serovar Java strain NCTC5706 
genome assembly, chromosome: 1
Length=4756780

 Score =  156 bits (84),  Expect = 7e-35
 Identities = 90/93 (96%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||
Sbjct  1611867  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTTAATGTCTGTTTACCCCTA  1611808

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1611807  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1611775


>gb|CP015724.1| Salmonella enterica strain C629, complete genome
Length=4791723

 Score =  156 bits (84),  Expect = 7e-35
 Identities = 90/93 (96%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1611542  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  1611483

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||| |||| ||||||||||||||||||
Sbjct  1611482  TTTCAACCGAATGCTTCGCATTCGGTTTTTTTT  1611450


>gb|CP014665.1| Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1766, 
complete genome
Length=4751034

 Score =  156 bits (84),  Expect = 7e-35
 Identities = 90/93 (96%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||
Sbjct  1619240  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCTTA  1619181

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1619180  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1619148


>gb|CP014664.1| Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1728, 
complete genome
Length=4783492

 Score =  156 bits (84),  Expect = 7e-35
 Identities = 90/93 (96%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||
Sbjct  1655774  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCTTA  1655715

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1655714  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1655682


>gb|CP014663.1| Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1677, 
complete genome
Length=4836394

 Score =  156 bits (84),  Expect = 7e-35
 Identities = 90/93 (96%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||
Sbjct  1617515  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCTTA  1617456

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1617455  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1617423


>gb|CP014661.1| Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1783, 
complete sequence
Length=4700848

 Score =  156 bits (84),  Expect = 7e-35
 Identities = 90/93 (96%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||
Sbjct  1612922  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCTTA  1612863

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1612862  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1612830


>gb|CP014659.1| Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1765, 
complete genome
Length=4946108

 Score =  156 bits (84),  Expect = 7e-35
 Identities = 90/93 (96%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||
Sbjct  1692888  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCTTA  1692829

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1692828  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1692796


>gb|CP014657.1| Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1736, 
complete genome
Length=4704371

 Score =  156 bits (84),  Expect = 7e-35
 Identities = 90/93 (96%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||
Sbjct  1619941  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCTTA  1619882

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1619881  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1619849


>gb|CP014621.1| Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1727, 
complete genome
Length=4894060

 Score =  156 bits (84),  Expect = 7e-35
 Identities = 90/93 (96%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||
Sbjct  1619031  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCTTA  1618972

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1618971  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1618939


>gb|CP014620.1| Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1676, 
complete genome
Length=4676958

 Score =  156 bits (84),  Expect = 7e-35
 Identities = 90/93 (96%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||
Sbjct  1586359  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCTTA  1586300

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1586299  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1586267


>gb|CP014996.1| Salmonella enterica subsp. enterica serovar Weltevreden str. 
1655, complete genome
Length=5047093

 Score =  156 bits (84),  Expect = 7e-35
 Identities = 90/93 (96%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||
Sbjct  1615406  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTATTTACCCCTA  1615347

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1615346  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1615314


>gb|CP013226.1| Salmonella enterica subsp. enterica serovar Anatum strain GT-38, 
complete genome
Length=4830607

 Score =  156 bits (84),  Expect = 7e-35
 Identities = 90/93 (96%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||
Sbjct  4817106  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCTTA  4817047

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  4817046  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  4817014


>gb|CP013222.1| Salmonella enterica subsp. enterica serovar Anatum strain GT-01, 
complete genome
Length=4879815

 Score =  156 bits (84),  Expect = 7e-35
 Identities = 90/93 (96%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||
Sbjct  4866327  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCTTA  4866268

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  4866267  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  4866235


>emb|LN890524.1| Salmonella enterica subsp. enterica serovar Weltevreden genome 
assembly 99_3134, chromosome : 1
Length=4966880

 Score =  156 bits (84),  Expect = 7e-35
 Identities = 90/93 (96%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||
Sbjct  2526787  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTATTTACCCCTA  2526846

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2526847  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2526879


>emb|LN890522.1| Salmonella enterica subsp. enterica serovar Weltevreden genome 
assembly 98_11262, chromosome : 1
Length=4875411

 Score =  156 bits (84),  Expect = 7e-35
 Identities = 90/93 (96%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||
Sbjct  2467058  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTATTTACCCCTA  2467117

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2467118  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2467150


>emb|LN890520.1| Salmonella enterica subsp. enterica serovar Weltevreden genome 
assembly C2346, chromosome : 1
Length=5129845

 Score =  156 bits (84),  Expect = 7e-35
 Identities = 90/93 (96%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||
Sbjct  2506366  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTATTTACCCCTA  2506425

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2506426  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2506458


>emb|LN890518.1| Salmonella enterica subsp. enterica serovar Weltevreden genome 
assembly 10259, chromosome : 1
Length=5062936

 Score =  156 bits (84),  Expect = 7e-35
 Identities = 90/93 (96%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||
Sbjct  2536723  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTATTTACCCCTA  2536782

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  2536783  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  2536815


>gb|CP012346.1| Salmonella enterica subsp. enterica serovar Panama str. ATCC 
7378, complete genome
Length=4555576

 Score =  156 bits (84),  Expect = 7e-35
 Identities = 90/93 (96%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1577643  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  1577584

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||| |||| ||||||||||||||||||
Sbjct  1577583  TTTCAACCGAATGCTTCGCATTCGGTTTTTTTT  1577551


>gb|CP011967.1| Salmonella enterica subsp. enterica serovar Paratyphi A strain 
CMCC50093 genome
Length=4585229

 Score =  156 bits (84),  Expect = 7e-35
 Identities = 90/93 (96%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  678355  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  678296

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||| |||| ||||||||||||||||||
Sbjct  678295  TTTCAACCGAATGCTTCGCATTCGGTTTTTTTT  678263


>gb|CP007483.1| Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1175, 
complete genome
Length=4731586

 Score =  156 bits (84),  Expect = 7e-35
 Identities = 90/93 (96%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||
Sbjct  1610870  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCTTA  1610811

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| ||||||||||||||||||
Sbjct  1610810  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  1610778


>gb|CP009049.1| Salmonella enterica subsp. enterica serovar Paratyphi A strain 
CMCC 50973, complete genome
Length=4599018

 Score =  156 bits (84),  Expect = 7e-35
 Identities = 90/93 (96%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1288797  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  1288738

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||| |||| ||||||||||||||||||
Sbjct  1288737  TTTCAACCGAATGCTTCGCATTCGGTTTTTTTT  1288705


>gb|CP009559.1| Salmonella enterica subsp. enterica serovar Paratyphi A strain 
CMCC 50503, complete genome
Length=4612373

 Score =  156 bits (84),  Expect = 7e-35
 Identities = 90/93 (96%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  196142  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  196201

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||| |||| ||||||||||||||||||
Sbjct  196202  TTTCAACCGAATGCTTCGCATTCGGTTTTTTTT  196234


>gb|CP006738.1| Klebsiella pneumoniae HK787, complete genome
Length=5329385

 Score =  156 bits (84),  Expect = 7e-35
 Identities = 90/93 (96%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||
Sbjct  1566319  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTATGTTTACCCCTA  1566260

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  1566259  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  1566227


>gb|CP006693.1| Salmonella enterica subsp. arizonae serovar 62:z36:- str. RKS2983, 
complete genome
Length=4574846

 Score =  156 bits (84),  Expect = 7e-35
 Identities = 90/93 (96%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct  606966  GCTATCATCATTAACTTTATTTATTACCGTCATTCATCTCTGAATGTCTGTTTACCCCTA  606907

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||| |||| ||||||||||||||||||
Sbjct  606906  TTTCAACCGAATGCTTCGCATTCGGTTTTTTTT  606874


>gb|CP006648.1| Klebsiella pneumoniae CG43, complete genome
Length=5166857

 Score =  156 bits (84),  Expect = 7e-35
 Identities = 90/93 (96%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||
Sbjct  2807321  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTATGTTTACCCCTA  2807380

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  2807381  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  2807413


>emb|FR775224.1| Salmonella enterica subsp. enterica serovar Weltevreden str. 
2007-60-3289-1 complete genome, contig 37
Length=293530

 Score =  156 bits (84),  Expect = 7e-35
 Identities = 90/93 (96%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               |||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||
Sbjct  286738  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTATTTACCCCTA  286797

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               |||||||||||||| ||||||||||||||||||
Sbjct  286798  TTTCAACCGGATGCTTCGCATTCGGTTTTTTTT  286830


>emb|FM200053.1| Salmonella enterica subsp. enterica serovar Paratyphi A str. 
AKU_12601 complete genome, strain AKU_12601
Length=4581797

 Score =  156 bits (84),  Expect = 7e-35
 Identities = 90/93 (96%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  678389  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  678330

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||| |||| ||||||||||||||||||
Sbjct  678329  TTTCAACCGAATGCTTCGCATTCGGTTTTTTTT  678297


>gb|CP000880.1| Salmonella enterica subsp. arizonae serovar 62:z4,z23:--, complete 
genome
Length=4600800

 Score =  156 bits (84),  Expect = 7e-35
 Identities = 90/93 (96%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct  628173  GCTATCATCATTAACTTTATTTATTACCGTCATTCATCTCTGAATGTCTGTTTACCCCTA  628114

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||| |||| ||||||||||||||||||
Sbjct  628113  TTTCAACCGAATGCTTCGCATTCGGTTTTTTTT  628081


>gb|CP000026.1| Salmonella enterica subsp. enterica serovar Paratyphi A str. 
ATCC 9150, complete genome
Length=4585229

 Score =  156 bits (84),  Expect = 7e-35
 Identities = 90/93 (96%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  678355  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  678296

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||| |||| ||||||||||||||||||
Sbjct  678295  TTTCAACCGAATGCTTCGCATTCGGTTTTTTTT  678263


>gb|CP000034.1| Shigella dysenteriae Sd197, complete genome
Length=4369232

 Score =  156 bits (84),  Expect = 7e-35
 Identities = 90/93 (96%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  809149  GCTATCACCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  809090

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||||||||| |||||||||||
Sbjct  809089  CTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  809057


>gb|CP007465.1| Salmonella enterica subsp. enterica serovar Enteritidis str. 
SA19940857 genome
Length=4707072

 Score =  154 bits (83),  Expect = 2e-34
 Identities = 90/93 (96%), Gaps = 1/93 (1%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  2361449  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  2361508

Query  61       TTTCAACCGGATGCCTCGCATTCG-Gttttttt  92
                |||||||||||||| ||||||||| ||||||||
Sbjct  2361509  TTTCAACCGGATGCTTCGCATTCGTGTTTTTTT  2361541


>gb|CP002099.1| Salmonella enterica subsp. enterica serovar Typhi str. Ty21a, 
complete genome
Length=4791958

 Score =  154 bits (83),  Expect = 2e-34
 Identities = 89/92 (96%), Gaps = 0/92 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  680849  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  680790

Query  61      TTTCAACCGGATGCCTCGCATTCGGttttttt  92
               |||||||||||||| || ||||||||||||||
Sbjct  680789  TTTCAACCGGATGCTTCACATTCGGTTTTTTT  680758


>gb|CP010557.1| Raoultella ornithinolytica strain S12, complete genome
Length=5522044

 Score =  150 bits (81),  Expect = 3e-33
 Identities = 89/93 (95%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  4366649  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  4366708

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||| ||||||||| |||||| |||||||||||
Sbjct  4366709  TTTCGACCGGATGCTTCGCATCCGGTTTTTTTT  4366741


>gb|CP003938.1| Enterobacteriaceae bacterium strain FGI 57, complete genome
Length=4762179

 Score =  150 bits (81),  Expect = 3e-33
 Identities = 89/93 (95%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  1478997  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  1478938

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||| ||||||||| |||||| |||||||||||
Sbjct  1478937  TTTCCACCGGATGCATCGCATCCGGTTTTTTTT  1478905


>gb|CP002272.1| Enterobacter lignolyticus SCF1, complete genome
Length=4814049

 Score =  150 bits (81),  Expect = 3e-33
 Identities = 89/93 (95%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||  ||
Sbjct  1590659  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCTGTA  1590600

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                ||||||||||||||||||||| |||||||||||
Sbjct  1590599  TTTCAACCGGATGCCTCGCATCCGGTTTTTTTT  1590567


>emb|Z33506.1| K.pneumoniae (C3) ompK36 gene for OmpK36 porin and micF gene
Length=1545

 Score =  150 bits (81),  Expect = 3e-33
 Identities = 89/93 (95%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1   GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  96  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCCCTA  37

Query  61  TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
           |||| ||||||||| |||||| |||||||||||
Sbjct  36  TTTCGACCGGATGCTTCGCATCCGGTTTTTTTT  4


>emb|Y15844.1| Salmonella minnesota ompC gene
Length=2111

 Score =  148 bits (80),  Expect = 1e-32
 Identities = 89/93 (95%), Gaps = 1/93 (1%)
 Strand=Plus/Minus

Query  1    GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
            |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  542  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  483

Query  61   TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
            ||||||||| |||| ||||||||| ||||||||
Sbjct  482  TTTCAACCGAATGCTTCGCATTCG-TTTTTTTT  451


>gb|CP014015.1| Citrobacter amalonaticus strain FDAARGOS_122, complete genome
Length=4904610

 Score =  145 bits (78),  Expect = 1e-31
 Identities = 89/94 (94%), Gaps = 2/94 (2%)
 Strand=Plus/Plus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  256058  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  256117

Query  61      TTTCAACCGGATGCC-TCGCATTCGGtttttttt  93
               ||||||||||||||  | || | |||||||||||
Sbjct  256118  TTTCAACCGGATGCGAT-GCGTCCGGTTTTTTTT  256150


>gb|CP014070.1| Citrobacter amalonaticus strain FDAARGOS_165, complete genome
Length=5030517

 Score =  145 bits (78),  Expect = 1e-31
 Identities = 89/94 (94%), Gaps = 2/94 (2%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2286575  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2286516

Query  61       TTTCAACCGGATGCC-TCGCATTCGGtttttttt  93
                ||||||||||||||  | || | |||||||||||
Sbjct  2286515  TTTCAACCGGATGCGAT-GCGTCCGGTTTTTTTT  2286483


>gb|CP012871.1| Klebsiella sp. G5, complete genome
Length=4702949

 Score =  145 bits (78),  Expect = 1e-31
 Identities = 88/93 (94%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||  ||
Sbjct  3126596  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTACCTGTA  3126655

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||| |||||| |||||||||||
Sbjct  3126656  TTTCAACCGGATGCATCGCATCCGGTTTTTTTT  3126688


>dbj|AP014857.1| Escherichia albertii DNA, complete genome, strain: EC06-170
Length=4657167

 Score =  145 bits (78),  Expect = 1e-31
 Identities = 88/93 (94%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2320965  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2321024

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||  || | | |||||||||||
Sbjct  2321025  TTTCAACCGGATGTATCACGTCCGGTTTTTTTT  2321057


>dbj|AP014856.1| Escherichia albertii DNA, complete genome, strain: CB9786
Length=4598983

 Score =  145 bits (78),  Expect = 1e-31
 Identities = 88/93 (94%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2240875  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2240934

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||  || | | |||||||||||
Sbjct  2240935  TTTCAACCGGATGTATCACGTCCGGTTTTTTTT  2240967


>dbj|AP014855.1| Escherichia albertii DNA, complete genome, strain: NIAH_Bird_3
Length=4560575

 Score =  145 bits (78),  Expect = 1e-31
 Identities = 88/93 (94%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2180317  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2180376

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||  || | | |||||||||||
Sbjct  2180377  TTTCAACCGGATGTATCACGTCCGGTTTTTTTT  2180409


>gb|CP012167.1| Enterobacter cloacae strain 34998, complete genome
Length=4688189

 Score =  145 bits (78),  Expect = 1e-31
 Identities = 88/93 (94%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||
Sbjct  3080779  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTATCCCTA  3080838

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                 || |||||||||| ||||||||||||||||||
Sbjct  3080839  ATTGAACCGGATGCTTCGCATTCGGTTTTTTTT  3080871


>gb|CP012165.1| Enterobacter cloacae strain 34978, complete genome
Length=4930963

 Score =  145 bits (78),  Expect = 1e-31
 Identities = 88/93 (94%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||
Sbjct  3220516  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTATCCCTA  3220575

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                 || |||||||||| ||||||||||||||||||
Sbjct  3220576  ATTGAACCGGATGCTTCGCATTCGGTTTTTTTT  3220608


>gb|CP010376.2| Enterobacter cloacae strain 34977, complete genome
Length=4897485

 Score =  145 bits (78),  Expect = 1e-31
 Identities = 88/93 (94%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||
Sbjct  3158086  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTATCCCTA  3158145

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                 || |||||||||| ||||||||||||||||||
Sbjct  3158146  ATTGAACCGGATGCTTCGCATTCGGTTTTTTTT  3158178


>gb|CP011650.1| Enterobacter cloacae strain CAV1669, complete genome
Length=4849467

 Score =  145 bits (78),  Expect = 1e-31
 Identities = 88/93 (94%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||
Sbjct  2715641  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTATCCCTA  2715700

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                 || |||||||||| ||||||||||||||||||
Sbjct  2715701  ATTGAACCGGATGCTTCGCATTCGGTTTTTTTT  2715733


>gb|CP011584.1| Enterobacter cloacae strain CAV1668, complete genome
Length=4876110

 Score =  145 bits (78),  Expect = 1e-31
 Identities = 88/93 (94%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||
Sbjct  2743114  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTATCCCTA  2743173

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                 || |||||||||| ||||||||||||||||||
Sbjct  2743174  ATTGAACCGGATGCTTCGCATTCGGTTTTTTTT  2743206


>gb|CP011581.1| Enterobacter cloacae strain CAV1411, complete genome
Length=4881003

 Score =  145 bits (78),  Expect = 1e-31
 Identities = 88/93 (94%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||
Sbjct  2188244  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTATCCCTA  2188185

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                 || |||||||||| ||||||||||||||||||
Sbjct  2188184  ATTGAACCGGATGCTTCGCATTCGGTTTTTTTT  2188152


>gb|CP011572.1| Enterobacter cloacae strain CAV1311, complete genome
Length=4879702

 Score =  145 bits (78),  Expect = 1e-31
 Identities = 88/93 (94%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||
Sbjct  4074531  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTATCCCTA  4074472

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                 || |||||||||| ||||||||||||||||||
Sbjct  4074471  ATTGAACCGGATGCTTCGCATTCGGTTTTTTTT  4074439


>gb|CP011132.1| Citrobacter amalonaticus Y19, complete genome
Length=5584358

 Score =  145 bits (78),  Expect = 1e-31
 Identities = 89/94 (94%), Gaps = 2/94 (2%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2575714  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2575773

Query  61       TTTCAACCGGATGCC-TCGCATTCGGtttttttt  93
                ||||||||||||||  | || | |||||||||||
Sbjct  2575774  TTTCAACCGGATGCGAT-GCGTCCGGTTTTTTTT  2575806


>gb|CP010384.1| Enterobacter cloacae strain 34399, complete genome
Length=4784288

 Score =  145 bits (78),  Expect = 1e-31
 Identities = 88/93 (94%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||
Sbjct  3169615  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTATCCCTA  3169674

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                 || |||||||||| ||||||||||||||||||
Sbjct  3169675  ATTGAACCGGATGCTTCGCATTCGGTTTTTTTT  3169707


>gb|CP008823.1| Enterobacter cloacae ECNIH2, complete genome
Length=4852980

 Score =  145 bits (78),  Expect = 1e-31
 Identities = 88/93 (94%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||
Sbjct  3271026  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTATCCCTA  3271085

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                 || |||||||||| ||||||||||||||||||
Sbjct  3271086  ATTGAACCGGATGCTTCGCATTCGGTTTTTTTT  3271118


>gb|CP007025.1| Escherichia albertii KF1, complete genome
Length=4701875

 Score =  145 bits (78),  Expect = 1e-31
 Identities = 88/93 (94%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3968500  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  3968441

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||||||||||||  || | | |||||||||||
Sbjct  3968440  TTTCAACCGGATGTATCACGTCCGGTTTTTTTT  3968408


>emb|FP929040.1| Enterobacter cloacae subsp. cloacae NCTC 9394 draft genome
Length=4908759

 Score =  145 bits (78),  Expect = 1e-31
 Identities = 88/93 (94%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||
Sbjct  4028437  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTATCCCTA  4028378

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                 || |||||||||| ||||||||||||||||||
Sbjct  4028377  ATTGAACCGGATGCTTCGCATTCGGTTTTTTTT  4028345


>emb|CU928158.2| Escherichia fergusonii ATCC 35469 chromosome, complete genome
Length=4588711

 Score =  145 bits (78),  Expect = 1e-31
 Identities = 88/93 (94%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
               ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct  972196  GCTATCATCATTAACTTTATTTATTACCGTCATTCATATCTGAATGTCTGTTTACCCCTA  972137

Query  61      TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               ||||||||||||||   |||| |||||||||||
Sbjct  972136  TTTCAACCGGATGCGAAGCATCCGGTTTTTTTT  972104


>gb|CP014280.1| Enterobacter cloacae isolate MBRL1077 genome
Length=4801156

 Score =  139 bits (75),  Expect = 7e-30
 Identities = 88/94 (93%), Gaps = 2/94 (2%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCAT-TTCTGAATGTCTGTTTACCCCT  59
                ||||||||||||||||||||||||||||||||||||  || |||||||||||||| ||||
Sbjct  1782989  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGCTT-TGAATGTCTGTTTATCCCT  1782931

Query  60       ATTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                | ||||||||||||| ||||||||||||||||||
Sbjct  1782930  AATTCAACCGGATGCATCGCATTCGGTTTTTTTT  1782897


>gb|CP014030.1| Citrobacter sp. FDAARGOS_156, complete genome
Length=4727434

 Score =  139 bits (75),  Expect = 7e-30
 Identities = 89/95 (93%), Gaps = 4/95 (4%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTC-TGAATGTCTGTTTACCCCT  59
                |||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||
Sbjct  3337793  GCTATCATCATTAACTTTATTTATTACCGTCATTCATT-CATGAATGTCTGTTTACCCCT  3337851

Query  60       ATTTCAACCGGATGC-CTCGCATTCGGtttttttt  93
                |||||||||| |||| || || |||||||||||||
Sbjct  3337852  ATTTCAACCGAATGCTCT-GCGTTCGGTTTTTTTT  3337885


>gb|CP012999.1| Enterobacter sp. E20, complete genome
Length=4763114

 Score =  139 bits (75),  Expect = 7e-30
 Identities = 88/94 (93%), Gaps = 2/94 (2%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCA-TTTCTGAATGTCTGTTTACCCCT  59
                |||||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||
Sbjct  3307603  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTT-TGAATGTCTGTTTATCCCT  3307661

Query  60       ATTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                | || |||||||||| ||||||||||||||||||
Sbjct  3307662  AATTGAACCGGATGCTTCGCATTCGGTTTTTTTT  3307695


>gb|CP011657.1| Citrobacter freundii strain CAV1741, complete genome
Length=5029496

 Score =  139 bits (75),  Expect = 7e-30
 Identities = 88/94 (93%), Gaps = 2/94 (2%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct  4525798  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTATGAATGTCTGTTTACCCCTA  4525739

Query  61       TTTCAACCGGATGCCTC-GCATTCGGtttttttt  93
                ||||| ||| |||| || || |||||||||||||
Sbjct  4525738  TTTCAGCCGAATGC-TCAGCGTTCGGTTTTTTTT  4525706


>gb|CP011612.1| Citrobacter freundii strain CAV1321, complete genome
Length=4976908

 Score =  139 bits (75),  Expect = 7e-30
 Identities = 88/94 (93%), Gaps = 2/94 (2%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct  1532818  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTATGAATGTCTGTTTACCCCTA  1532877

Query  61       TTTCAACCGGATGCCTC-GCATTCGGtttttttt  93
                ||||| ||| |||| || || |||||||||||||
Sbjct  1532878  TTTCAGCCGAATGC-TCAGCGTTCGGTTTTTTTT  1532910


>gb|CP010377.1| Enterobacter cloacae strain 34983, complete genome
Length=4632074

 Score =  139 bits (75),  Expect = 7e-30
 Identities = 88/94 (93%), Gaps = 2/94 (2%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCA-TTTCTGAATGTCTGTTTACCCCT  59
                |||||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||
Sbjct  3069906  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTT-TGAATGTCTGTTTATCCCT  3069964

Query  60       ATTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                | || |||||||||| ||||||||||||||||||
Sbjct  3069965  AATTGAACCGGATGCTTCGCATTCGGTTTTTTTT  3069998


>gb|CP009854.1| Enterobacter cloacae strain ECNIH5, complete genome
Length=4626882

 Score =  139 bits (75),  Expect = 7e-30
 Identities = 88/94 (93%), Gaps = 2/94 (2%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||
Sbjct  3137212  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTATCCCTA  3137271

Query  61       TTTCAACCGGATGCCTC-GCATTCGGtttttttt  93
                 || |||||||||| || ||||||||||||||||
Sbjct  3137272  ATTGAACCGGATGC-TCCGCATTCGGTTTTTTTT  3137304


>gb|CP009756.1| Enterobacter cloacae strain GGT036, complete genome
Length=4848754

 Score =  139 bits (75),  Expect = 7e-30
 Identities = 88/94 (93%), Gaps = 2/94 (2%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCAT-TTCTGAATGTCTGTTTACCCCT  59
                ||||||||||||||||||||||||||||||||||||  || |||||||||||||| ||||
Sbjct  3328531  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGCTT-TGAATGTCTGTTTATCCCT  3328589

Query  60       ATTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                | ||||||||||||| ||||||||||||||||||
Sbjct  3328590  AATTCAACCGGATGCTTCGCATTCGGTTTTTTTT  3328623


>gb|CP008905.1| Enterobacter cloacae ECR091, complete genome
Length=4621385

 Score =  139 bits (75),  Expect = 7e-30
 Identities = 88/94 (93%), Gaps = 2/94 (2%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||
Sbjct  3133088  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTATCCCTA  3133147

Query  61       TTTCAACCGGATGCCTC-GCATTCGGtttttttt  93
                 || |||||||||| || ||||||||||||||||
Sbjct  3133148  ATTGAACCGGATGC-TCCGCATTCGGTTTTTTTT  3133180


>gb|CP008897.1| Enterobacter cloacae ECNIH3, complete genome
Length=4633407

 Score =  139 bits (75),  Expect = 7e-30
 Identities = 88/94 (93%), Gaps = 2/94 (2%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||
Sbjct  3143738  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTTATCCCTA  3143797

Query  61       TTTCAACCGGATGCCTC-GCATTCGGtttttttt  93
                 || |||||||||| || ||||||||||||||||
Sbjct  3143798  ATTGAACCGGATGC-TCCGCATTCGGTTTTTTTT  3143830


>gb|CP007557.1| Citrobacter freundii CFNIH1, complete genome
Length=5099034

 Score =  139 bits (75),  Expect = 7e-30
 Identities = 89/95 (93%), Gaps = 4/95 (4%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTC-TGAATGTCTGTTTACCCCT  59
                |||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||
Sbjct  4643505  GCTATCATCATTAACTTTATTTATTACCGTCATTCATT-CATGAATGTCTGTTTACCCCT  4643563

Query  60       ATTTCAACCGGATGC-CTCGCATTCGGtttttttt  93
                |||||||||| |||| || || |||||||||||||
Sbjct  4643564  ATTTCAACCGAATGCTCT-GCGTTCGGTTTTTTTT  4643597


>gb|CP003678.1| Enterobacter cloacae subsp. dissolvens SDM, complete genome
Length=4968248

 Score =  139 bits (75),  Expect = 7e-30
 Identities = 88/94 (93%), Gaps = 2/94 (2%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCAT-TTCTGAATGTCTGTTTACCCCT  59
                ||||||||||||||||||||||||||||||||||||  || |||||||||||||| ||||
Sbjct  3403777  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGCTT-TGAATGTCTGTTTATCCCT  3403835

Query  60       ATTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                | ||||||||||||| ||||||||||||||||||
Sbjct  3403836  AATTCAACCGGATGCTTCGCATTCGGTTTTTTTT  3403869


>gb|CP001918.1| Enterobacter cloacae subsp. cloacae ATCC 13047, complete genome
Length=5314581

 Score =  139 bits (75),  Expect = 7e-30
 Identities = 88/94 (93%), Gaps = 2/94 (2%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCAT-TTCTGAATGTCTGTTTACCCCT  59
                ||||||||||||||||||||||||||||||||||||  || |||||||||||||| ||||
Sbjct  3603366  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGCTT-TGAATGTCTGTTTATCCCT  3603424

Query  60       ATTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                | ||||||||||||| ||||||||||||||||||
Sbjct  3603425  AATTCAACCGGATGCTTCGCATTCGGTTTTTTTT  3603458


>gb|CP010512.1| Enterobacter cloacae strain colR/S, complete genome
Length=4828976

 Score =  134 bits (72),  Expect = 3e-28
 Identities = 88/95 (92%), Gaps = 4/95 (4%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCA-TTTCTGAATGTCTGTTTACCCCT  59
                |||||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||
Sbjct  2581582  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTT-TGAATGTCTGTTTATCCCT  2581524

Query  60       ATTTCAACCGGATGCCTC-GCATTCGGtttttttt  93
                | || |||||||||| || ||||||||||||||||
Sbjct  2581523  AATTGAACCGGATGC-TCCGCATTCGGTTTTTTTT  2581490


>gb|CP011863.1| Enterobacter asburiae strain ATCC 35953, complete sequence
Length=4713742

 Score =  134 bits (72),  Expect = 3e-28
 Identities = 88/95 (92%), Gaps = 4/95 (4%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCA-TTTCTGAATGTCTGTTTACCCCT  59
                |||||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||
Sbjct  2358598  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTT-TGAATGTCTGTTTATCCCT  2358656

Query  60       ATTTCAACCGGATGCCTC-GCATTCGGtttttttt  93
                | || |||||||||| || ||||||||||||||||
Sbjct  2358657  AATTGAACCGGATGC-TCCGCATTCGGTTTTTTTT  2358690


>gb|CP012162.1| Enterobacter asburiae strain 35734, complete genome
Length=5017289

 Score =  134 bits (72),  Expect = 3e-28
 Identities = 87/94 (92%), Gaps = 2/94 (2%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCA-TTTCTGAATGTCTGTTTACCCCT  59
                |||||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||
Sbjct  3294534  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTT-TGAATGTCTGTTTATCCCT  3294592

Query  60       ATTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                | || | |||||||| ||||||||||||||||||
Sbjct  3294593  AATTGAGCCGGATGCTTCGCATTCGGTTTTTTTT  3294626


>gb|CP011602.1| Kluyvera intermedia strain CAV1151, complete genome
Length=5529134

 Score =  134 bits (72),  Expect = 3e-28
 Identities = 87/94 (92%), Gaps = 2/94 (2%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTC-ATTTCTGAATGTCTGTTTACCCCT  59
               ||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||
Sbjct  801141  GCTATCATCATTAACTTTATTTATTACCGTCATTCGATT-CTGAATGTCTGTTTACCCCT  801083

Query  60      ATTTCAACCGGATGCCTCGCATTCGGtttttttt  93
               |||   |||| |||||| ||||||||||||||||
Sbjct  801082  ATTAGGACCGAATGCCTGGCATTCGGTTTTTTTT  801049


>gb|CP011591.1| Enterobacter asburiae strain CAV1043, complete genome
Length=4753402

 Score =  134 bits (72),  Expect = 3e-28
 Identities = 88/95 (92%), Gaps = 4/95 (4%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCA-TTTCTGAATGTCTGTTTACCCCT  59
                |||||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||
Sbjct  4640151  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTT-TGAATGTCTGTTTATCCCT  4640093

Query  60       ATTTCAACCGGATGCCTC-GCATTCGGtttttttt  93
                | || |||||||||| || ||||||||||||||||
Sbjct  4640092  AATTGAACCGGATGC-TCCGCATTCGGTTTTTTTT  4640059


>gb|CP007546.1| Enterobacter asburiae L1, complete genome
Length=4561905

 Score =  134 bits (72),  Expect = 3e-28
 Identities = 88/95 (92%), Gaps = 4/95 (4%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCA-TTTCTGAATGTCTGTTTACCCCT  59
               |||||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||
Sbjct  810995  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTT-TGAATGTCTGTTTATCCCT  810937

Query  60      ATTTCAACCGGATGCCTC-GCATTCGGtttttttt  93
               | || |||||||||| || ||||||||||||||||
Sbjct  810936  AATTGAACCGGATGC-TCCGCATTCGGTTTTTTTT  810903


>gb|CP005991.1| Enterobacter sp. R4-368, complete genome
Length=5039027

 Score =  134 bits (72),  Expect = 3e-28
 Identities = 88/95 (92%), Gaps = 4/95 (4%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTC-ATTTCTGAATGTCTGTTTACCCCT  59
                ||||||||||||||||||||||||||||||||||| | | ||||||||||||||||||||
Sbjct  1349464  GCTATCATCATTAACTTTATTTATTACCGTCATTCGAAT-CTGAATGTCTGTTTACCCCT  1349522

Query  60       ATT-TCAACCGGATGCCTCGCATTCGGtttttttt  93
                 || | |||||||||| ||||||||||||||||||
Sbjct  1349523  CTTAT-AACCGGATGCGTCGCATTCGGTTTTTTTT  1349556


>gb|CP012554.1| Citrobacter freundii strain P10159, complete genome
Length=5080321

 Score =  130 bits (70),  Expect = 4e-27
 Identities = 86/93 (92%), Gaps = 3/93 (3%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct  4557042  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTATGAATGTCTGTTTACCCCTA  4556983

Query  61       TTTCAACCGGATGC-CTCGCATTCGGttttttt  92
                ||||| ||| |||| || || |||| |||||||
Sbjct  4556982  TTTCAGCCGAATGCTCT-GCGTTCG-TTTTTTT  4556952


>gb|CP015227.1| Enterobacter sp. ODB01, complete genome
Length=4534036

 Score =  128 bits (69),  Expect = 1e-26
 Identities = 86/94 (91%), Gaps = 2/94 (2%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCA-TTTCTGAATGTCTGTTTACCCCT  59
                |||||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||
Sbjct  4187722  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTT-TGAATGTCTGTTTATCCCT  4187780

Query  60       ATTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                | || | ||| |||| ||||||||||||||||||
Sbjct  4187781  AATTGAGCCGAATGCATCGCATTCGGTTTTTTTT  4187814


>gb|CP014993.1| Enterobacter asburiae strain ENIPBJ-CG1, complete genome
Length=4648696

 Score =  128 bits (69),  Expect = 1e-26
 Identities = 87/95 (91%), Gaps = 4/95 (4%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCA-TTTCTGAATGTCTGTTTACCCCT  59
                |||||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||
Sbjct  4590371  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTT-TGAATGTCTGTTTATCCCT  4590313

Query  60       ATTTCAACCGGATGCCTC-GCATTCGGtttttttt  93
                | || |||||||||| || |||||| |||||||||
Sbjct  4590312  AATTGAACCGGATGC-TCCGCATTCTGTTTTTTTT  4590279


>gb|CP012487.1| Enterobacter sp. FY-07, complete genome
Length=5118646

 Score =  128 bits (69),  Expect = 1e-26
 Identities = 87/95 (91%), Gaps = 4/95 (4%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTC-ATTTCTGAATGTCTGTTTACCCCT  59
                ||||||||||||||||||||||||||||||||||| | | ||||||||||||||||||||
Sbjct  1644480  GCTATCATCATTAACTTTATTTATTACCGTCATTCGAAT-CTGAATGTCTGTTTACCCCT  1644422

Query  60       ATT-TCAACCGGATGCCTCGCATTCGGtttttttt  93
                 || | | |||||||| ||||||||||||||||||
Sbjct  1644421  CTTATGA-CCGGATGCTTCGCATTCGGTTTTTTTT  1644388


>gb|CP011798.1| Enterobacter cloacae strain UW5, complete genome
Length=4904981

 Score =  128 bits (69),  Expect = 1e-26
 Identities = 86/94 (91%), Gaps = 2/94 (2%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCAT-TTCTGAATGTCTGTTTACCCCT  59
                ||||||||||||||||||||||||||||||||||||  || |||||||||||||| ||||
Sbjct  3845800  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGATT-TGAATGTCTGTTTATCCCT  3845858

Query  60       ATTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                | ||| |||| |||||| ||||||||||||||||
Sbjct  3845859  AATTCTACCGAATGCCTGGCATTCGGTTTTTTTT  3845892


>gb|CP009850.1| Enterobacter cloacae strain ECNIH4, complete genome
Length=4761385

 Score =  128 bits (69),  Expect = 1e-26
 Identities = 86/94 (91%), Gaps = 2/94 (2%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCA-TTTCTGAATGTCTGTTTACCCCT  59
                |||||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||
Sbjct  1537286  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTT-TGAATGTCTGTTTATCCCT  1537228

Query  60       ATTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                | || | ||| |||| ||||||||||||||||||
Sbjct  1537227  AATTGAGCCGAATGCATCGCATTCGGTTTTTTTT  1537194


>gb|CP009450.1| Pluralibacter gergoviae strain FB2, complete genome
Length=5489680

 Score =  128 bits (69),  Expect = 1e-26
 Identities = 85/93 (91%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||  |||||||| | |||||||| ||
Sbjct  2551501  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGCTCTGAATGCCAGTTTACCCTTA  2551442

Query  61       TTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                || ||||||||||| |||||| |||||||||||
Sbjct  2551441  TTCCAACCGGATGCTTCGCATCCGGTTTTTTTT  2551409


>gb|CP007215.2| Enterobacter sacchari SP1, complete genome
Length=4902024

 Score =  128 bits (69),  Expect = 1e-26
 Identities = 87/95 (91%), Gaps = 4/95 (4%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTC-ATTTCTGAATGTCTGTTTACCCCT  59
                ||||||||||||||||||||||||||||||||||| | | |||||||||||||||||| |
Sbjct  4713883  GCTATCATCATTAACTTTATTTATTACCGTCATTCGAAT-CTGAATGTCTGTTTACCCTT  4713825

Query  60       ATT-TCAACCGGATGCCTCGCATTCGGtttttttt  93
                 || | |||||||||| ||||||||||||||||||
Sbjct  4713824  CTTAT-AACCGGATGCTTCGCATTCGGTTTTTTTT  4713791


>gb|CP006580.1| Enterobacter cloacae P101, complete genome
Length=5369929

 Score =  128 bits (69),  Expect = 1e-26
 Identities = 86/94 (91%), Gaps = 2/94 (2%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCAT-TTCTGAATGTCTGTTTACCCCT  59
                ||||||||||||||||||||||||||||||||||||  || |||||||||||||| ||||
Sbjct  1826620  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGATT-TGAATGTCTGTTTATCCCT  1826562

Query  60       ATTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                | ||| |||| |||||| ||||||||||||||||
Sbjct  1826561  AATTCTACCGAATGCCTGGCATTCGGTTTTTTTT  1826528


>gb|CP003737.1| Enterobacter cloacae subsp. cloacae ENHKU01, complete genome
Length=4726582

 Score =  128 bits (69),  Expect = 1e-26
 Identities = 86/94 (91%), Gaps = 2/94 (2%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCA-TTTCTGAATGTCTGTTTACCCCT  59
                |||||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||
Sbjct  3252801  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTT-TGAATGTCTGTTTATCCCT  3252859

Query  60       ATTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                | || | ||| |||| ||||||||||||||||||
Sbjct  3252860  AATTGAGCCGAATGCATCGCATTCGGTTTTTTTT  3252893


>gb|CP002886.1| Enterobacter cloacae EcWSU1, complete genome
Length=4734438

 Score =  128 bits (69),  Expect = 1e-26
 Identities = 86/94 (91%), Gaps = 2/94 (2%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCAT-TTCTGAATGTCTGTTTACCCCT  59
                ||||||||||||||||||||||||||||||||||||  || |||||||||||||| ||||
Sbjct  3241762  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGATT-TGAATGTCTGTTTATCCCT  3241820

Query  60       ATTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                | ||| |||| |||||| ||||||||||||||||
Sbjct  3241821  AATTCTACCGAATGCCTGGCATTCGGTTTTTTTT  3241854


>gb|CP003026.1| Enterobacter asburiae LF7a, complete genome
Length=4812833

 Score =  128 bits (69),  Expect = 1e-26
 Identities = 86/94 (91%), Gaps = 2/94 (2%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCA-TTTCTGAATGTCTGTTTACCCCT  59
                |||||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||
Sbjct  3181302  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTT-TGAATGTCTGTTTATCCCT  3181360

Query  60       ATTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                | || ||||| |||||  ||||||||||||||||
Sbjct  3181361  AATTGAACCGAATGCCGAGCATTCGGTTTTTTTT  3181394


>emb|FN543502.1| Citrobacter rodentium ICC168, complete genome
Length=5346659

 Score =  128 bits (69),  Expect = 1e-26
 Identities = 86/94 (91%), Gaps = 1/94 (1%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2466438  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  2466497

Query  61       TTTCAACCGGATGCCT-CGCATTCGGtttttttt  93
                ||||| ||| | |  | | | |||||||||||||
Sbjct  2466498  TTTCAGCCGAACGTTTTCACGTTCGGTTTTTTTT  2466531


>gb|M31424.1|STYOMPC S.typhi outer membrane protein (ompC) gene, complete cds
Length=1639

 Score =  124 bits (67),  Expect = 2e-25
 Identities = 69/70 (98%), Gaps = 0/70 (0%)
 Strand=Plus/Minus

Query  1   GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  70  GCTATCATCATTAACTTTATTTATTACCGTCATTCACTTCTGAATGTCTGTTTACCCCTA  11

Query  61  TTTCAACCGG  70
           ||||||||||
Sbjct  10  TTTCAACCGG  1


>gb|CP000653.1| Enterobacter sp. 638, complete genome
Length=4518712

 Score =  117 bits (63),  Expect = 3e-23
 Identities = 85/95 (89%), Gaps = 4/95 (4%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTTACCCCTA  60
                ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||
Sbjct  3023674  GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTTTGAATGTCTGTTTATCCCTA  3023733

Query  61       TTTCAACCG-GATGCC-TCGCATTCGGtttttttt  93
                 || | ||| | |||  | ||||||||||||||||
Sbjct  3023734  ATTGAGCCGAG-TGCAAT-GCATTCGGTTTTTTTT  3023766


>gb|CP011077.1| Klebsiella michiganensis strain RC10, complete genome
Length=5107633

 Score =  115 bits (62),  Expect = 1e-22
 Identities = 85/95 (89%), Gaps = 5/95 (5%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTC-ATTTCTGAATGTCTGTTTACCCCT  59
                ||||||||||||||||||||||||||||||||||| | | ||||||||| ||||||||||
Sbjct  3346856  GCTATCATCATTAACTTTATTTATTACCGTCATTCGAAT-CTGAATGTCCGTTTACCCCT  3346914

Query  60       ATTT-CAACCGGATGCCTCGCATTCGGtttttttt  93
                |||  || |||||||| | |||| |||||||||||
Sbjct  3346915  ATTAGCA-CCGGATGCTT-GCATCCGGTTTTTTTT  3346947


>gb|CP009459.1| Cedecea neteri strain ND14a, complete genome
Length=4659311

 Score =  115 bits (62),  Expect = 1e-22
 Identities = 84/94 (89%), Gaps = 3/94 (3%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTC-ATTTCTGAATGTCTGTTTACCCCT  59
                ||||||||||||||||||||||||||||||||||| | | ||||||||| ||||||||||
Sbjct  4226907  GCTATCATCATTAACTTTATTTATTACCGTCATTCGAAT-CTGAATGTCCGTTTACCCCT  4226965

Query  60       ATTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||   ||||||||| | |||| |||||||||||
Sbjct  4226966  ATTAGTACCGGATGCTT-GCATCCGGTTTTTTTT  4226998


>gb|CP009458.1| Cedecea neteri strain M006, complete genome
Length=4965436

 Score =  115 bits (62),  Expect = 1e-22
 Identities = 84/94 (89%), Gaps = 3/94 (3%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTC-ATTTCTGAATGTCTGTTTACCCCT  59
                ||||||||||||||||||||||||||||||||||| | | ||||||||| ||||||||||
Sbjct  4526285  GCTATCATCATTAACTTTATTTATTACCGTCATTCGAAT-CTGAATGTCCGTTTACCCCT  4526343

Query  60       ATTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||   ||||||||| | |||| |||||||||||
Sbjct  4526344  ATTAGTACCGGATGCTT-GCATCCGGTTTTTTTT  4526376


>gb|CP009451.1| Cedecea neteri strain SSMD04, complete genome
Length=4876443

 Score =  115 bits (62),  Expect = 1e-22
 Identities = 84/94 (89%), Gaps = 3/94 (3%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTC-ATTTCTGAATGTCTGTTTACCCCT  59
                ||||||||||||||||||||||||||||||||||| | | ||||||||| ||||||||||
Sbjct  4170900  GCTATCATCATTAACTTTATTTATTACCGTCATTCGAAT-CTGAATGTCCGTTTACCCCT  4170842

Query  60       ATTTCAACCGGATGCCTCGCATTCGGtttttttt  93
                |||    |||||||| |||||| |||||||||||
Sbjct  4170841  ATTAGTGCCGGATGC-TCGCATCCGGTTTTTTTT  4170809


>gb|CP013990.1| Leclercia adecarboxylata strain USDA-ARS-USMARC-60222, complete 
genome
Length=4803917

 Score =  111 bits (60),  Expect = 1e-21
 Identities = 84/95 (88%), Gaps = 4/95 (4%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCAT-TTCTGAATGTCTGTTTACCCCT  59
                ||||||||||||||||||||||||||||||||||||  || |||||||||||||| ||  
Sbjct  1510326  GCTATCATCATTAACTTTATTTATTACCGTCATTCAAATT-TGAATGTCTGTTTATCCAG  1510268

Query  60       ATTTCAACCGGATGC-CTCGCATTCGGtttttttt  93
                | || ||||| |||| || ||||||||||||||||
Sbjct  1510267  AATTGAACCGAATGCACT-GCATTCGGTTTTTTTT  1510234


>gb|CP012264.1| Cronobacter condimenti 1330 strain LMG 26250, complete genome
Length=4347991

 Score =  111 bits (60),  Expect = 1e-21
 Identities = 85/96 (88%), Gaps = 5/96 (5%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGT-CTGTTT-ACCCC  58
                ||||||||||||||||||||||||||||||||||||| ||||||||| | |||| |||||
Sbjct  2903060  GCTATCATCATTAACTTTATTTATTACCGTCATTCATATCTGAATGTTC-GTTTTACCCC  2903118

Query  59       TATTTCAACCGGATGCCTCGCATTCGGt-ttttttt  93
                |||| |  |||||||| |||||| |||  |||||||
Sbjct  2903119  TATTACCGCCGGATGC-TCGCATCCGGCATTTTTTT  2903153


>gb|CP012266.1| Cronobacter dublinensis subsp. dublinensis LMG 23823, complete 
genome
Length=4431067

 Score =  108 bits (58),  Expect = 2e-20
 Identities = 85/97 (87%), Gaps = 6/97 (6%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGT-CTGTTT-ACCCC  58
                ||||||||||||||||||||||||||||||||||||| ||||||||| | |||| |||||
Sbjct  3049520  GCTATCATCATTAACTTTATTTATTACCGTCATTCATATCTGAATGTTC-GTTTTACCCC  3049578

Query  59       TATTT-CAACCGGATGCCTCGCATTCGGt-ttttttt  93
                || || |  |||||||| |||||| |||  |||||||
Sbjct  3049579  TAATTACCGCCGGATGC-TCGCATCCGGCATTTTTTT  3049614


>emb|FN543093.2| Cronobacter turicensis z3032 complete genome
Length=4384463

 Score =  108 bits (58),  Expect = 2e-20
 Identities = 85/97 (87%), Gaps = 6/97 (6%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGT-CTGTTT-ACCCC  58
                ||||||||||||||||||||||||||||||||||||  ||||||||| | |||| |||||
Sbjct  2998530  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGATCTGAATGTTC-GTTTTACCCC  2998588

Query  59       TATTTCAACCGGATGCCTCGCATTCGG--tttttttt  93
                |||| |  |||||||| |||||| |||  ||||||||
Sbjct  2998589  TATTACCGCCGGATGC-TCGCATCCGGCATTTTTTTT  2998624


>gb|CP013940.1| Cronobacter malonaticus LMG 23826, complete genome
Length=4294639

 Score =  106 bits (57),  Expect = 7e-20
 Identities = 84/96 (87%), Gaps = 5/96 (5%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGT-CTGTTT-ACCCC  58
                ||||||||||||||||||||||||||||||||||||  ||||||||| | |||| |||||
Sbjct  1237881  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGATCTGAATGTTC-GTTTTACCCC  1237823

Query  59       TATTTCAACCGGATGCCTCGCATTCGGt-ttttttt  93
                |||| |  |||||||| |||||| |||  |||||||
Sbjct  1237822  TATTACCGCCGGATGC-TCGCATCCGGCATTTTTTT  1237788


>gb|CP012268.1| Cronobacter muytjensii ATCC 51329, complete genome
Length=4364114

 Score =  106 bits (57),  Expect = 7e-20
 Identities = 84/96 (87%), Gaps = 5/96 (5%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGT-CTGTTT-ACCCC  58
                ||||||||||||||||||||||||||||||||||||| ||||||||| | |||| |||||
Sbjct  1030440  GCTATCATCATTAACTTTATTTATTACCGTCATTCATATCTGAATGTTC-GTTTTACCCC  1030382

Query  59       TATTTCAACCGGATGCCTCGCATTCGGt-ttttttt  93
                |||| |  |||||||| | |||| |||  |||||||
Sbjct  1030381  TATTACCGCCGGATGCTT-GCATCCGGCATTTTTTT  1030347


>gb|CP012257.1| Cronobacter universalis NCTC 9529, complete genome
Length=4307096

 Score =  106 bits (57),  Expect = 7e-20
 Identities = 84/96 (87%), Gaps = 5/96 (5%)
 Strand=Plus/Plus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGT-CTGTTT-ACCCC  58
                ||||||||||||||||||||||||||||||||||||  ||||||||| | |||| |||||
Sbjct  2917738  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGATCTGAATGTTC-GTTTTACCCC  2917796

Query  59       TATTTCAACCGGATGCCTCGCATTCGGt-ttttttt  93
                |||| |  |||||||| |||||| |||  |||||||
Sbjct  2917797  TATTACCGCCGGATGC-TCGCATCCGGCATTTTTTT  2917831


>gb|CP012253.1| Cronobacter sakazakii strain NCTC 8155, complete genome
Length=4329295

 Score =  106 bits (57),  Expect = 7e-20
 Identities = 84/96 (87%), Gaps = 5/96 (5%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGT-CTGTTT-ACCCC  58
                ||||||||||||||||||||||||||||||||||||  ||||||||| | |||| |||||
Sbjct  1009622  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGATCTGAATGTTC-GTTTTACCCC  1009564

Query  59       TATTTCAACCGGATGCCTCGCATTCGGt-ttttttt  93
                |||| |  |||||||| |||||| |||  |||||||
Sbjct  1009563  TATTACCGCCGGATGC-TCGCATCCGGCATTTTTTT  1009529


>gb|CP011047.1| Cronobacter sakazakii strain ATCC 29544, complete genome
Length=4511265

 Score =  106 bits (57),  Expect = 7e-20
 Identities = 84/96 (87%), Gaps = 5/96 (5%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGT-CTGTTT-ACCCC  58
                ||||||||||||||||||||||||||||||||||||  ||||||||| | |||| |||||
Sbjct  2431800  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGATCTGAATGTTC-GTTTTACCCC  2431742

Query  59       TATTTCAACCGGATGCCTCGCATTCGGt-ttttttt  93
                |||| |  |||||||| |||||| |||  |||||||
Sbjct  2431741  TATTACCGCCGGATGC-TCGCATCCGGCATTTTTTT  2431707


>gb|CP006731.1| Cronobacter sakazakii CMCC 45402, complete genome
Length=4377544

 Score =  106 bits (57),  Expect = 7e-20
 Identities = 84/96 (87%), Gaps = 5/96 (5%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGT-CTGTTT-ACCCC  58
                ||||||||||||||||||||||||||||||||||||  ||||||||| | |||| |||||
Sbjct  1380520  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGATCTGAATGTTC-GTTTTACCCC  1380462

Query  59       TATTTCAACCGGATGCCTCGCATTCGGt-ttttttt  93
                |||| |  |||||||| |||||| |||  |||||||
Sbjct  1380461  TATTACCGCCGGATGC-TCGCATCCGGCATTTTTTT  1380427


>gb|CP004091.1| Cronobacter sakazakii SP291, complete genome
Length=4344092

 Score =  106 bits (57),  Expect = 7e-20
 Identities = 84/96 (87%), Gaps = 5/96 (5%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGT-CTGTTT-ACCCC  58
                ||||||||||||||||||||||||||||||||||||  ||||||||| | |||| |||||
Sbjct  1031423  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGATCTGAATGTTC-GTTTTACCCC  1031365

Query  59       TATTTCAACCGGATGCCTCGCATTCGGt-ttttttt  93
                |||| |  |||||||| |||||| |||  |||||||
Sbjct  1031364  TATTACCGCCGGATGC-TCGCATCCGGCATTTTTTT  1031330


>gb|CP003312.1| Cronobacter sakazakii ES15, complete genome
Length=4268675

 Score =  106 bits (57),  Expect = 7e-20
 Identities = 84/96 (87%), Gaps = 5/96 (5%)
 Strand=Plus/Minus

Query  1        GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGT-CTGTTT-ACCCC  58
                ||||||||||||||||||||||||||||||||||||  ||||||||| | |||| |||||
Sbjct  1315220  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGATCTGAATGTTC-GTTTTACCCC  1315162

Query  59       TATTTCAACCGGATGCCTCGCATTCGGt-ttttttt  93
                |||| |  |||||||| |||||| |||  |||||||
Sbjct  1315161  TATTACCGCCGGATGC-TCGCATCCGGCATTTTTTT  1315127


>gb|CP000783.1| Cronobacter sakazakii ATCC BAA-894, complete genome
Length=4368373

 Score =  106 bits (57),  Expect = 7e-20
 Identities = 84/96 (87%), Gaps = 5/96 (5%)
 Strand=Plus/Minus

Query  1       GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGT-CTGTTT-ACCCC  58
               ||||||||||||||||||||||||||||||||||||  ||||||||| | |||| |||||
Sbjct  948322  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGATCTGAATGTTC-GTTTTACCCC  948264

Query  59      TATTTCAACCGGATGCCTCGCATTCGGt-ttttttt  93
               |||| |  |||||||| |||||| |||  |||||||
Sbjct  948263  TATTACCGCCGGATGC-TCGCATCCGGCATTTTTTT  948229


>gb|JX291114.1| Klebsiella pneumoniae strain HS062105 OmpK36 porin (ompk36) gene, 
complete cds
Length=1507

 Score = 93.5 bits (50),  Expect = 5e-16
 Identities = 52/53 (98%), Gaps = 0/53 (0%)
 Strand=Plus/Plus

Query  1     GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTT  53
             |||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct  1455  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTT  1507


>gb|JX310557.1| Klebsiella pneumoniae strain HS08763 Ompk36 (ompk36) gene, complete 
cds
Length=1480

 Score = 93.5 bits (50),  Expect = 5e-16
 Identities = 52/53 (98%), Gaps = 0/53 (0%)
 Strand=Plus/Plus

Query  1     GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTT  53
             |||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct  1428  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTT  1480


>gb|JX310552.1| Klebsiella pneumoniae strain HS092187 Ompk36 (ompk36) gene, complete 
cds
Length=1507

 Score = 93.5 bits (50),  Expect = 5e-16
 Identities = 52/53 (98%), Gaps = 0/53 (0%)
 Strand=Plus/Plus

Query  1     GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTT  53
             |||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct  1455  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTT  1507


>gb|JX310551.1| Klebsiella pneumoniae strain HS082847 Ompk36 (ompk36) gene, complete 
cds
Length=1486

 Score = 93.5 bits (50),  Expect = 5e-16
 Identities = 52/53 (98%), Gaps = 0/53 (0%)
 Strand=Plus/Plus

Query  1     GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTT  53
             |||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct  1434  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTT  1486


>gb|JX310550.1| Klebsiella pneumoniae strain HS082416 Ompk36 (ompk36) gene, complete 
cds
Length=1486

 Score = 93.5 bits (50),  Expect = 5e-16
 Identities = 52/53 (98%), Gaps = 0/53 (0%)
 Strand=Plus/Plus

Query  1     GCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAATGTCTGTTT  53
             |||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct  1434  GCTATCATCATTAACTTTATTTATTACCGTCATTCAGTTCTGAATGTCTGTTT  1486



Lambda     K      H
    1.33    0.621     1.12 

Gapped
Lambda     K      H
    1.28    0.460    0.850 

Effective search space used: 7274851291920


  Database: Nucleotide collection (nt)
    Posted date:  May 25, 2016  1:56 PM
  Number of letters in database: 118,474,747,968
  Number of sequences in database:  36,723,768



Matrix: blastn matrix 1 -2
Gap Penalties: Existence: 0, Extension: 2.5